Phenotypic Mutation 'Potter2' (pdf version)
Allele | Potter2 |
Mutation Type |
missense
|
Chromosome | 15 |
Coordinate | 78,449,654 bp (GRCm39) |
Base Change | T ⇒ C (forward strand) |
Gene |
Rac2
|
Gene Name | Rac family small GTPase 2 |
Chromosomal Location |
78,443,369-78,456,983 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013] PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_009008; MGI:97846
|
Mapped | Yes |
Limits of the Critical Region |
78559169 - 78572783 bp |
Amino Acid Change |
Asparagine changed to Serine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000036384]
[ENSMUSP00000154826 †]
† probably from a misspliced transcript
|
AlphaFold |
Q05144 |
SMART Domains |
Protein: ENSMUSP00000036384 Gene: ENSMUSG00000033220 AA Change: N92S
Domain | Start | End | E-Value | Type |
RHO
|
6 |
179 |
3.36e-135 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
(Using ENSMUST00000043214)
|
Predicted Effect |
probably benign
|
Predicted Effect |
probably benign
|
Meta Mutation Damage Score |
0.9322 |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Unknown |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(9) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(2) Radiation induced(2) Targeted(1)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL02931:Rac2
|
APN |
15 |
78454947 |
missense |
possibly damaging |
0.79 |
Big_bend
|
UTSW |
15 |
78450145 |
missense |
possibly damaging |
0.95 |
bingo
|
UTSW |
15 |
78449168 |
missense |
probably damaging |
1.00 |
Lamb
|
UTSW |
15 |
78449134 |
missense |
possibly damaging |
0.68 |
Migrant
|
UTSW |
15 |
78450223 |
missense |
probably damaging |
0.96 |
Potter
|
UTSW |
15 |
78454943 |
nonsense |
probably null |
|
wheel
|
UTSW |
15 |
78450206 |
missense |
probably benign |
0.29 |
R0557:Rac2
|
UTSW |
15 |
78449174 |
missense |
probably damaging |
1.00 |
R0627:Rac2
|
UTSW |
15 |
78449168 |
missense |
probably damaging |
1.00 |
R0751:Rac2
|
UTSW |
15 |
78450145 |
missense |
possibly damaging |
0.95 |
R1184:Rac2
|
UTSW |
15 |
78450145 |
missense |
possibly damaging |
0.95 |
R2349:Rac2
|
UTSW |
15 |
78449675 |
missense |
possibly damaging |
0.51 |
R3816:Rac2
|
UTSW |
15 |
78450199 |
missense |
possibly damaging |
0.75 |
R4436:Rac2
|
UTSW |
15 |
78454943 |
nonsense |
probably null |
|
R5051:Rac2
|
UTSW |
15 |
78449134 |
missense |
possibly damaging |
0.68 |
R5207:Rac2
|
UTSW |
15 |
78449654 |
missense |
probably damaging |
0.97 |
R7384:Rac2
|
UTSW |
15 |
78446131 |
nonsense |
probably null |
|
R8482:Rac2
|
UTSW |
15 |
78450206 |
missense |
probably benign |
0.29 |
R8938:Rac2
|
UTSW |
15 |
78446112 |
missense |
probably damaging |
0.98 |
R9231:Rac2
|
UTSW |
15 |
78450223 |
missense |
probably damaging |
0.96 |
|
Mode of Inheritance |
Unknown |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:40 PM
by Anne Murray
|
Record Created |
2017-05-17 11:54 PM
by Jin Huk Choi
|
Record Posted |
2017-08-18 |
Phenotypic Description |
The Potter2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5207, some of which showed an increase in the B:T cell ratio (Figure 1) as well as a reduced CD4 to CD8 T cell ratio (Figure 2). Some mice showed reduced frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD4+ T cells in CD3+ T cells (Figure 5), naive CD4 T cells in CD4 T cells (Figure 6), CD8+ T cells (Figure 7), and naive CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of CD44+ T cells (Figure 9), CD44+ CD8 T cells (Figure 10), CD8+ T cells in CD3+ T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), effector memory CD8 T cells in CD8 T cells (Figure 13), central memory CD4 T cells in CD4 T cells (Figure 14), and effector memory CD4 T cells in CD4 T cells (Figure 15), all in the peripheral blood. The expression of B220 (Figure 16) and IgD (Figure 17) were reduced on peripheral B cells and the expression of CD44 was increased on peripheral T cells (Figure 18), CD4 T cells (Figure 19), and CD8 T cells (Figure 20). The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 21) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 22) were also diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also reduced (Figure 23). The rates of cytotoxic T lymphocyte (Figure 24)- and natural killer cell (Figure 25)-mediated target cell killing was reduced. The amount of total IgE in the serum was reduced seven days after OVA/Alum challenge (Figure 26).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 15: Rac2 and Tcf20. The mutation in Rac2 was presumed to be causative because the potter2 phenotypes mimic other known alleles of Rac2 (see MGI for a list of Rac2 alleles). The mutation in Rac2 is an A to G transition at base pair 78,565,454 (v38) on chromosome 15, or base pair 7,330 in the GenBank genomic region NC_000081 encoding the Rac2 gene. The strongest association was found with an additive model of inheritance to the normalized amount of CD44 on CD8 T cells phenotype, wherein two variant homozygotes and 36 heterozygous mice departed phenotypically from 34 homozygous reference mice with a P value of 2.42 x 10-36 (Figure 27). Although a substantial semidominant effect was observed in most of the assays, some assays exhibited strongest linkage with a recessive model of inheritance or with a dominant model of inheritance. The mutation corresponds to residue 413 in the mRNA sequence NM_009008 within exon 4 of 7 total exons.
397 CCAGCCTCCTATGAGAATGTCCGTGCCAAGTGG
87 -P--A--S--Y--E--N--V--R--A--K--W-
|
The mutated nucleotide is indicated in red. The mutation results in an asparagine to serine substitution at position 92 (N92S) in the Rac2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.971).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 28; (1)]. G-boxes function in GDP binding and exhibit GTPase activity (2). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (3). The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase. The mutation in Potter2 results in an asparagine to serine substitution at position 92 (N92S). Amino acid 65 is within an undefined region between the G3 and G4 regions. For more information about Rac2, please see the record for bingo.
|
Putative Mechanism | Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. Rac2 functions in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O2−) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts (4-9). The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β2 integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (10). Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (11;12). Rac2-deficient (Rac2-/-) mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (11). Rac2-/- mice also display a lack of peritoneal B1 and marginal zone B cells (11). In the peripheral blood, Rac2-/- mice had an increase in total leukocyte number including both B and T cells (11). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (11). In humans, mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (13-15)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (13-15). The immune phenotypes observed in Potter2 indicates a loss of Rac2Potter2 function; however, some Rac2 function may remain or Rac1 may be compensating for the loss of Rac2 function and/or expression as other Rac2-/--associated phenotypes were not observed in the Potter2 mice.
|
Primers |
PCR Primer
Potter2_pcr_F: AAGAGTCAAGCGAGTTTGTGTG
Potter2_pcr_R: TTTCTCAGTGTGTGCCAGGC
Sequencing Primer
Potter2_seq_F: TTGTGTGTTGATAAGAAGAGGCAC
Potter2_seq_R: CTTCTGGGTCCCTAGAGCTG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 528 nucleotides is amplified (chromosome 15, - strand):
1 tttctcagtg tgtgccaggc aggggctagt gtgcctggag ctggggtagg caggtggcct 61 gctgcagggg actctgtggc ttctgggtcc ctagagctgg gctctctacc cacaagggca 121 aagggagtcg gcaggtagat ggttatggga gccgagggat ggtttcccag acaggaccct 181 ggcctcccta tgctaacctg ccctgttctg tatttaggat gtatttctca tctgcttctc 241 gctagtcagc ccagcctcct atgagaatgt ccgtgccaag gtgagccacg agtggcctgg 301 gaagggtgct gaggaaaggg gaatgggcta tcctgggtta ggagaggcca ggggagagag 361 ggtcactagt accacacagg accaatgaga ggagagtctc cttgggctgt gtgtgtgttg 421 tggggggagg ggtgggacag tgagggttcc tcctgcctct gagccctgtc cctttgtcta 481 tccaacctcg tgcctcttct tatcaacaca caaactcgct tgactctt
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
3. Yamauchi, A., Marchal, C. C., Molitoris, J., Pech, N., Knaus, U., Towe, J., Atkinson, S. J., and Dinauer, M. C. (2005) Rac GTPase Isoform-Specific Regulation of NADPH Oxidase and Chemotaxis in Murine Neutrophils in Vivo. Role of the C-Terminal Polybasic Domain. J Biol Chem. 280, 953-964.
4. Gu, Y., Filippi, M. D., Cancelas, J. A., Siefring, J. E., Williams, E. P., Jasti, A. C., Harris, C. E., Lee, A. W., Prabhakar, R., Atkinson, S. J., Kwiatkowski, D. J., and Williams, D. A. (2003) Hematopoietic Cell Regulation by Rac1 and Rac2 Guanosine Triphosphatases. Science. 302, 445-449.
5. Kalfa, T. A., Pushkaran, S., Mohandas, N., Hartwig, J. H., Fowler, V. M., Johnson, J. F., Joiner, C. H., Williams, D. A., and Zheng, Y. (2006) Rac GTPases Regulate the Morphology and Deformability of the Erythrocyte Cytoskeleton. Blood. 108, 3637-3645.
6. Itokowa, T., Zhu, M. L., Troiano, N., Bian, J., Kawano, T., and Insogna, K. (2011) Osteoclasts Lacking Rac2 have Defective Chemotaxis and Resorptive Activity. Calcif Tissue Int. 88, 75-86.
7. Roberts, A. W., Kim, C., Zhen, L., Lowe, J. B., Kapur, R., Petryniak, B., Spaetti, A., Pollock, J. D., Borneo, J. B., Bradford, G. B., Atkinson, S. J., Dinauer, M. C., and Williams, D. A. (1999) Deficiency of the Hematopoietic Cell-Specific Rho Family GTPase Rac2 is Characterized by Abnormalities in Neutrophil Function and Host Defense. Immunity. 10, 183-196.
8. Yang, F. C., Atkinson, S. J., Gu, Y., Borneo, J. B., Roberts, A. W., Zheng, Y., Pennington, J., and Williams, D. A. (2001) Rac and Cdc42 GTPases Control Hematopoietic Stem Cell Shape, Adhesion, Migration, and Mobilization. Proc Natl Acad Sci U S A. 98, 5614-5618.
9. Yang, F. C., Kapur, R., King, A. J., Tao, W., Kim, C., Borneo, J., Breese, R., Marshall, M., Dinauer, M. C., and Williams, D. A. (2000) Rac2 Stimulates Akt Activation Affecting BAD/Bcl-XL Expression while Mediating Survival and Actin Function in Primary Mast Cells. Immunity. 12, 557-568.
10. Wheeler, A. P., Wells, C. M., Smith, S. D., Vega, F. M., Henderson, R. B., Tybulewicz, V. L., and Ridley, A. J. (2006) Rac1 and Rac2 Regulate Macrophage Morphology but are Not Essential for Migration. J Cell Sci. 119, 2749-2757.
11. Croker, B. A., Tarlinton, D. M., Cluse, L. A., Tuxen, A. J., Light, A., Yang, F. C., Williams, D. A., and Roberts, A. W. (2002) The Rac2 Guanosine Triphosphatase Regulates B Lymphocyte Antigen Receptor Responses and Chemotaxis and is Required for Establishment of B-1a and Marginal Zone B Lymphocytes. J Immunol. 168, 3376-3386.
12. Walmsley, M. J., Ooi, S. K., Reynolds, L. F., Smith, S. H., Ruf, S., Mathiot, A., Vanes, L., Williams, D. A., Cancro, M. P., and Tybulewicz, V. L. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302, 459-462.
13. Williams, D. A., Tao, W., Yang, F., Kim, C., Gu, Y., Mansfield, P., Levine, J. E., Petryniak, B., Derrow, C. W., Harris, C., Jia, B., Zheng, Y., Ambruso, D. R., Lowe, J. B., Atkinson, S. J., Dinauer, M. C., and Boxer, L. (2000) Dominant Negative Mutation of the Hematopoietic-Specific Rho GTPase, Rac2, is Associated with a Human Phagocyte Immunodeficiency. Blood. 96, 1646-1654.
14. Ambruso, D. R., Knall, C., Abell, A. N., Panepinto, J., Kurkchubasche, A., Thurman, G., Gonzalez-Aller, C., Hiester, A., deBoer, M., Harbeck, R. J., Oyer, R., Johnson, G. L., and Roos, D. (2000) Human Neutrophil Immunodeficiency Syndrome is Associated with an Inhibitory Rac2 Mutation. Proc Natl Acad Sci U S A. 97, 4654-4659.
15. Gu, Y., Jia, B., Yang, F. C., D'Souza, M., Harris, C. E., Derrow, C. W., Zheng, Y., and Williams, D. A. (2001) Biochemical and Biological Characterization of a Human Rac2 GTPase Mutant Associated with Phagocytic Immunodeficiency. J Biol Chem. 276, 15929-15938.
|
Science Writers | Anne Murray |
Illustrators | Katherine Timer |
Authors | Jin Huk Choi, Braden Hayse, Xue Zhong, Evan Nair-Gill, and Bruce Beutler |