Phenotypic Mutation 'morula'

• Allele: morula
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 98,802,672 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Lmbr1l
• Gene Name: limb region 1 like
• Synonym(s): D15Ertd735e, 1110013E13Rik
• Chromosomal Location: 98,801,798-98,815,944 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000023736] [ENSMUSP00000104755]
• AlphaFold: Q9D1E5
• SMART Domains: Protein: ENSMUSP00000023736; Gene: ENSMUSG00000022999; AA Change: R426C

Domain	Start	End	E-Value	Type
Pfam:LMBR1	28	269	2e-41	PFAM
Pfam:LMBR1	266	450	1.2e-35	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000023736)
• SMART Domains: Protein: ENSMUSP00000104755; Gene: ENSMUSG00000022999

Domain	Start	End	E-Value	Type
Pfam:LMBR1	1	324	6.3e-110	PFAM

• Predicted Effect: noncoding transcript
• Meta Mutation Damage Score: 0.8953
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:29 PM by Anne Murray
• Record Created: 2019-01-30 1:47 PM by Bruce Beutler
• Record Posted: 2019-05-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_029098; MGI:1289247

Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1) Gene trapped(1) Radiation induced(2) Targeted(5)

Phenotypic Description

Figure 1. Morula mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The morula phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5436, some of which showed increased frequencies of central memory CD4 T cells in CD4 T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased central memory CD4 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R5436. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. The increased central memory CD4 T cell frequency phenotype was linked by continuous variable mapping to mutations in three genes on chromosome 15: Gxylt1, Lmbr1l, and Larp4. The mutation in Lmbr1l was presumed causative, and is a C to T transition at base pair 98,904,791 (v38) on chromosome 15, or base pair 13,458 in the GenBank genomic region NC_000081 encoding Lmbr1l. Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from 14 homozygous reference mice and 14 heterozygous mice with a P value of 0.000260 (Figure 2).  

The mutation corresponds to residue 1,453 in the mRNA sequence NM_029098 within exon 16 of 17 total exons.

1438 CTGGGTGACTTTGGACGCTTCAACTGGCTAGGC 421  -L--G--D--F--G--R--F--N--W--L--G-

The mutated nucleotide is indicated in red. The mutation results in an arginine to cysteine substitution at position 426 (R426C) in the LMBR1L protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 3. Domain organization and topography of LMBR1L. The morula mutation results in an arginine to cysteine substitution at position 426. Other mutations found in the protein are noted in red. Click on each allele for more information.

LMBR1L (alternatively, lipocalin-interacting membrane receptor; LIMR) is one of four lipocalin receptors (i.e., LMBR1L, megalin, 24p3R, and STRA6). Megalin is an endocytic receptor (1). Upon binding of its ligand (the lipocalin 24p3), 24p3R internalizes the lipocalin, subsequently regulating intracellular iron levels and apoptosis (2). STRA6 is a receptor for retinol binding protein, and mediates uptake of retinol from holo-retinol binding protein (3). The lipocalin receptors do not share sequence homology with each other or with other receptor families; however, the receptors may share similarities in their topography in the lipid bilayer (4).

LMBR1L has an extracellular N-terminus, nine putative transmembrane domains, a large intracellular loop between the fifth and sixth transmembrane domains, and an intracellular C-terminus (5). The LMBR1L extracellular N-terminus contains a putative lipocalin (LCN1) binding site and binding sites for other putative ligands (see the Background section for more information on LMBR1L ligands) [(5-7); reviewed in (4)].

LMBR1L is predicted to form dimers and higher order oligomers (4).

The morula mutation results in an arginine to cysteine substitution at position 426 (R426C); amino acid 426 is within the extracellular loop between transmembrane domains eight and nine.

Please see the record for strawberry for more information about Lmbr1l.

Putative Mechanism

LMBR1L functions as a receptor for several ligands, including LCN1, bovine lipocalin β-lactoglobulin [BLG] (6), the LCN1 porcine homolog von Ebner's gland protein [pVEG], and the secretoglobin uteroglobin [UG]) (7)) [(5); reviewed in (4)]. The biological significance of LMBR1L binding to many of its ligands, including non-human proteins, is largely unknown. Two of the ligands (e.g., LCN1 and BLG) were internalized in NT2 human teratocarcinoma cell line in a LMBR1L-dependent manner, leading to their degradation (5;6;8). Further studies using single cycle kinetics experiments showed that while LMBR1L is a specific receptor for LCN1, it does not show high affinity for pVEG, UG, or BLG (4). These findings indicate that either LMBR1L is not a receptor for pVEG, UG, or BLG, or that these putative ligands bind the receptor at sites distinct from that of LCN1 that are unexposed, inaccessible, or inactive.

LMBR1L is a putative negative regulator of the Wnt/β-catenin and ERAD signaling pathways independent of its function in lipocalin binding (9). Within the ER, LMBR1L is a component of a destruction complex along with GP78 and UBAC2, which functions to regulate Wnt receptor availability and subsequent Wnt signaling activity. LMBR1L also regulates the expression and/or stabilization of the β-catenin destruction complex through its participation in the GP78-UBAC2 complex.

Mice homozygous for a Lmbr1l gene disruption display normal morphology, clinical chemistry, hematology, and behavior (MGI:3604480).

LMBR1L functions in T and B cell differentiation (9). In Lmbr1l-deficient mice, loss of LMBR1L expression resulted in upregulation of the expression of mature forms of the Wnt co-receptors and phosphorylated GSK3β with concomitant reduced expression of several destruction complex proteins. As a result, β-catenin accumulated, entered the nucleus, and promoted the transcription of target genes (e.g., Myc, Trp53, and Cd44). The phenotype of the morula mice indicates loss of LMBR1L-associated function in T cell differentiation.

Primers

PCR Primer
morula_pcr_F: ACAACCTCTTCTCTGCTGGG
morula_pcr_R: CATTCAGTAGTCCTGGTCTGG

Sequencing Primer
morula_seq_F: TTCTCTGCTGGGGCCAC
morula_seq_R: CCTGGAGTGGGCTTGTCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 412 nucleotides is amplified (chromosome 15, - strand):

1   cattcagtag tcctggtctg gcctggagtg ggcttgtcag gcatgcacag cagatgctag
61  gtaacagttg tgatgttcag tcgtggccgc taggaggcag cagaaagttg gtctcctttg
121 aggagagggc ttgggggatt gccccttctg atggcggact ttgtacttca ggcctgacac
181 gctttgacct gctgggtgac tttggacgct tcaactggct aggcaatttc tacatcgtgt
241 tcctctacaa cgcagccttt gctggcctca ccacactctg tctggtgaag accttcacgg
301 cagctgtgag ggcagagctg atccgagcct ttggtaaggg catatggagc ccgggttggc
361 tgctggggag ttcattttgc agcaggggtg gccccagcag agaagaggtt gt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Christensen, E. I., and Birn, H. (2002) Megalin and Cubilin: Multifunctional Endocytic Receptors. Nat Rev Mol Cell Biol. 3, 256-266.

  2. Devireddy, L. R., Gazin, C., Zhu, X., and Green, M. R. (2005) A Cell-Surface Receptor for Lipocalin 24p3 Selectively Mediates Apoptosis and Iron Uptake. Cell. 123, 1293-1305.

  3. Kawaguchi, R., Yu, J., Honda, J., Hu, J., Whitelegge, J., Ping, P., Wiita, P., Bok, D., and Sun, H. (2007) A Membrane Receptor for Retinol Binding Protein Mediates Cellular Uptake of Vitamin A. Science. 315, 820-825.

  4. Hesselink, R. W., and Findlay, J. B. (2013) Expression, Characterization and Ligand Specificity of Lipocalin-1 Interacting Membrane Receptor (LIMR). Mol Membr Biol. 30, 327-337.

  5. Wojnar, P., Lechner, M., Merschak, P., and Redl, B. (2001) Molecular Cloning of a Novel Lipocalin-1 Interacting Human Cell Membrane Receptor using Phage Display. J Biol Chem. 276, 20206-20212.

  6. Fluckinger, M., Merschak, P., Hermann, M., Haertle, T., and Redl, B. (2008) Lipocalin-Interacting-Membrane-Receptor (LIMR) Mediates Cellular Internalization of Beta-Lactoglobulin. Biochim Biophys Acta. 1778, 342-347.

  7. Zhang, Z., Kim, S. J., Chowdhury, B., Wang, J., Lee, Y. C., Tsai, P. C., Choi, M., and Mukherjee, A. B. (2006) Interaction of Uteroglobin with Lipocalin-1 Receptor Suppresses Cancer Cell Motility and Invasion. Gene. 369, 66-71.

  8. Wojnar, P., Lechner, M., and Redl, B. (2003) Antisense Down-Regulation of Lipocalin-Interacting Membrane Receptor Expression Inhibits Cellular Internalization of Lipocalin-1 in Human NT2 Cells. J Biol Chem. 278, 16209-16215.

  9. Choi, J. H., Zhong, X., McAlpine, W., Liao, T. C., Zhang, D., Fang, B., Russell, J., Ludwig, S., Nair-Gill, E., Zhang, Z., Wang, K. W., Misawa, T., Zhan, X., Choi, M., Wang, T., Li, X., Tang, M., Sun, Q., Yu, L., Murray, A. R., Moresco, E. M. Y., and Beutler, B. (2019) LMBR1L Regulates Lymphopoiesis through Wnt/beta-Catenin Signaling. Science. 364, 10.1126/science.aau0812.