Incidental Mutation 'R1322:Mgat4d'
ID157714
Institutional Source Beutler Lab
Gene Symbol Mgat4d
Ensembl Gene ENSMUSG00000035057
Gene NameMGAT4 family, member C
Synonyms4933434I20Rik
MMRRC Submission 039388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1322 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83348471-83382320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83365725 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 247 (T247A)
Ref Sequence ENSEMBL: ENSMUSP00000041629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038692
AA Change: T247A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041629
Gene: ENSMUSG00000035057
AA Change: T247A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_54 70 373 5.9e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139692
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Col27a1 A C 4: 63,328,566 probably benign Het
Fam184a G T 10: 53,652,319 D815E probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gpr162 G T 6: 124,858,901 T512K probably damaging Het
Hipk1 A T 3: 103,743,981 S1155R probably damaging Het
Itih2 A G 2: 10,109,522 V417A probably damaging Het
Kmt2a A G 9: 44,821,121 probably benign Het
Mecom G T 3: 29,957,373 P670Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr830 T C 9: 18,875,521 F65L possibly damaging Het
Polr1c T C 17: 46,244,163 K327R possibly damaging Het
Prpf39 A T 12: 65,042,662 N58I possibly damaging Het
Sh3bp2 T A 5: 34,555,493 N92K probably damaging Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Tcrg-C3 T C 13: 19,261,194 F104S probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Vmn2r88 T G 14: 51,414,108 I293S probably damaging Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp930 A G 8: 69,228,168 T171A probably benign Het
Other mutations in Mgat4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Mgat4d APN 8 83354796 missense probably benign 0.21
IGL01634:Mgat4d APN 8 83368116 missense possibly damaging 0.71
IGL01987:Mgat4d APN 8 83368102 missense probably damaging 1.00
IGL02084:Mgat4d APN 8 83368981 missense possibly damaging 0.72
R0546:Mgat4d UTSW 8 83355721 missense possibly damaging 0.94
R1526:Mgat4d UTSW 8 83369037 missense probably benign 0.25
R1617:Mgat4d UTSW 8 83365711 missense probably damaging 1.00
R2223:Mgat4d UTSW 8 83355672 splice site probably benign
R3157:Mgat4d UTSW 8 83354821 missense probably benign
R3421:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R3422:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R4387:Mgat4d UTSW 8 83371706 missense probably damaging 1.00
R4796:Mgat4d UTSW 8 83358120 missense probably damaging 1.00
R4805:Mgat4d UTSW 8 83358158 splice site probably null
R5054:Mgat4d UTSW 8 83368208 splice site probably null
R6366:Mgat4d UTSW 8 83368951 splice site probably null
R6927:Mgat4d UTSW 8 83354867 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCAGGTACTGCCCACTCAATGAAG -3'
(R):5'- TGGGTTCAGGCATGAACACAGG -3'

Sequencing Primer
(F):5'- CTCAATGAAGATGAGAGGCTCTTTAG -3'
(R):5'- GGGATTTCTAATTCCTCTCAGTAGC -3'
Posted On2014-02-18