Incidental Mutation 'R1195:Fam129b'
ID164492
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R1195 (G1)
Quality Score158
Status Not validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32919803 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 304 (V304A)
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028135]
Predicted Effect probably benign
Transcript: ENSMUST00000028135
AA Change: V304A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796
AA Change: V304A

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154514
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 92.8%
  • 20x: 76.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6011:Fam129b UTSW 2 32922865 missense probably damaging 0.99
R6088:Fam129b UTSW 2 32923123 missense probably damaging 1.00
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6763:Fam129b UTSW 2 32911448 critical splice donor site probably null
R6769:Fam129b UTSW 2 32895654
Predicted Primers PCR Primer
(F):5'- TCTCCGTCCTAGATCCTAAGCAACC -3'
(R):5'- GAAGGATTGCACTCTGAGGAAGCTG -3'

Sequencing Primer
(F):5'- TCCTAAGCAACCTGGTGATG -3'
(R):5'- TCTGAGGAAGCTGGCCTG -3'
Posted On2014-03-28