Incidental Mutation 'R1464:Kcnj4'
ID165362
Institutional Source Beutler Lab
Gene Symbol Kcnj4
Ensembl Gene ENSMUSG00000044216
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 4
SynonymsMB-IRK3, Kir 2.3, Kcnf2, IRK3
MMRRC Submission 039518-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1464 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79483714-79505241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79485404 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 125 (L125P)
Ref Sequence ENSEMBL: ENSMUSP00000094075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057801]
Predicted Effect probably damaging
Transcript: ENSMUST00000057801
AA Change: L125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094075
Gene: ENSMUSG00000044216
AA Change: L125P

DomainStartEndE-ValueType
Pfam:IRK 22 361 2.1e-155 PFAM
coiled coil region 371 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229365
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.0%
  • 10x: 91.0%
  • 20x: 72.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,225,403 probably null Het
6030469F06Rik A G 12: 31,184,915 noncoding transcript Het
Adamts8 T A 9: 30,951,377 W86R probably benign Het
Adh1 A G 3: 138,288,747 probably null Het
Adipor2 A T 6: 119,361,843 W150R probably damaging Het
Aff4 T A 11: 53,372,524 S124T probably damaging Het
Ahnak G T 19: 9,004,896 K1181N probably damaging Het
Alkbh5 A G 11: 60,539,047 I209V probably benign Het
Ankrd11 T C 8: 122,892,724 E1442G probably damaging Het
Apba2 T A 7: 64,695,549 D162E probably benign Het
Asic3 G A 5: 24,413,821 G37E probably damaging Het
AU040320 A T 4: 126,792,031 K133N possibly damaging Het
C1qtnf7 A G 5: 43,609,139 S34G probably benign Het
Ccdc148 T A 2: 58,906,362 R463* probably null Het
Ccdc148 T C 2: 58,934,443 R329G probably damaging Het
Ccdc185 A G 1: 182,748,698 I142T probably benign Het
Chrna10 G A 7: 102,114,247 P114S probably damaging Het
Chst10 A G 1: 38,865,691 I311T probably damaging Het
Cpne9 T C 6: 113,294,737 Y353H probably damaging Het
Cubn G T 2: 13,325,288 A2594E possibly damaging Het
Cyp3a13 T C 5: 137,905,565 N277S possibly damaging Het
Dctn4 A G 18: 60,538,406 T117A probably damaging Het
Ddah1 A T 3: 145,853,274 K96* probably null Het
Ddx5 A C 11: 106,784,885 D326E probably benign Het
Dlg2 T C 7: 91,968,198 S323P probably damaging Het
Dnaaf1 C T 8: 119,579,310 H109Y probably damaging Het
Dnah8 C A 17: 30,695,173 R1098S possibly damaging Het
Dnajc13 T C 9: 104,214,167 T642A probably benign Het
Dnajc18 A G 18: 35,680,847 S290P possibly damaging Het
Dscam T A 16: 96,801,253 H663L possibly damaging Het
Emc1 A G 4: 139,370,937 N740S probably damaging Het
Enpp2 C T 15: 54,863,812 G541D probably damaging Het
Fam234b C T 6: 135,228,492 T485I probably benign Het
Fbxl13 A T 5: 21,483,991 I773K probably benign Het
Fmo4 A G 1: 162,794,355 F429S possibly damaging Het
Frem1 T C 4: 83,011,879 S277G probably damaging Het
Gaa A G 11: 119,272,984 I221V probably benign Het
Gm12794 T A 4: 101,941,306 L158Q probably damaging Het
Gm6614 C T 6: 141,992,517 W225* probably null Het
H2afy A T 13: 56,083,136 S310T probably damaging Het
Helz2 T C 2: 181,239,654 E345G probably damaging Het
Ifna4 G T 4: 88,842,000 R47I probably damaging Het
Igsf21 C A 4: 140,034,525 A281S probably benign Het
Ikzf3 T A 11: 98,516,905 I37L probably benign Het
Jag1 T C 2: 137,115,648 E48G probably damaging Het
Jarid2 G T 13: 44,848,381 V57F probably damaging Het
Kif21b A G 1: 136,156,153 K713E possibly damaging Het
Layn T A 9: 51,057,586 S286C probably damaging Het
Lepr T A 4: 101,735,681 D164E probably benign Het
Map3k1 T C 13: 111,755,871 H950R possibly damaging Het
Map4k5 C A 12: 69,805,350 V801L possibly damaging Het
Mapkbp1 T A 2: 120,021,261 S895T probably benign Het
Naca T A 10: 128,048,288 M2157K probably damaging Het
Nav2 T C 7: 49,362,204 I61T probably damaging Het
Nkx2-5 C A 17: 26,839,279 A234S probably benign Het
Nol8 G A 13: 49,676,788 S1116N probably benign Het
Nppa T C 4: 148,000,847 S5P probably benign Het
Nup210 A G 6: 91,053,569 V123A possibly damaging Het
Olfr532 G T 7: 140,419,373 N133K probably benign Het
Osbpl11 A G 16: 33,229,085 K604R probably damaging Het
Osbpl1a C T 18: 12,914,558 S113N probably benign Het
P2rx4 C A 5: 122,714,539 P92Q probably damaging Het
Pde9a A T 17: 31,473,162 Q148L probably benign Het
Phf21b T A 15: 84,804,959 H122L probably damaging Het
Pik3ca T A 3: 32,461,841 F977I probably damaging Het
Pp2d1 T G 17: 53,515,987 K17T possibly damaging Het
Ppp4r2 A G 6: 100,866,566 E415G probably damaging Het
Prkg1 A G 19: 30,578,870 S559P probably damaging Het
Prss45 A T 9: 110,840,951 Y276F possibly damaging Het
Ptk7 G T 17: 46,572,591 N849K probably damaging Het
Rnf121 A G 7: 102,031,575 I125T possibly damaging Het
Rnf17 A G 14: 56,461,911 N502S probably damaging Het
Sap25 T A 5: 137,642,360 Y167* probably null Het
Sdk2 G A 11: 113,830,080 T1341I possibly damaging Het
Sgcb A G 5: 73,635,553 V302A probably benign Het
Skor1 T A 9: 63,140,111 M865L possibly damaging Het
Slc35g1 C A 19: 38,403,217 L316I probably benign Het
Spint4 T A 2: 164,698,648 L33H probably damaging Het
Sptlc3 A T 2: 139,547,234 D178V probably benign Het
Tbc1d2 T A 4: 46,606,491 Y818F possibly damaging Het
Tbc1d24 A T 17: 24,181,223 probably null Het
Teddm2 C T 1: 153,850,531 W146* probably null Het
Ttn T A 2: 76,758,994 D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 T102A probably damaging Het
Uxs1 G A 1: 43,764,916 Q280* probably null Het
Vmn1r167 T C 7: 23,505,256 T112A possibly damaging Het
Vmn1r195 A T 13: 22,279,178 I273L probably benign Het
Vmn1r28 T A 6: 58,265,232 M20K probably benign Het
Vmn1r53 G A 6: 90,223,932 L137F probably benign Het
Vps13b C T 15: 35,709,484 A1859V probably benign Het
Vwa5b2 A G 16: 20,596,269 H347R probably benign Het
Wnk2 G A 13: 49,081,975 P655S probably damaging Het
Zan T G 5: 137,419,929 D2969A unknown Het
Zbtb24 A G 10: 41,455,079 H334R probably damaging Het
Zfp108 A G 7: 24,260,548 D188G probably benign Het
Zfp784 A T 7: 5,035,801 C253S possibly damaging Het
Zfr T G 15: 12,146,372 C336W probably damaging Het
Other mutations in Kcnj4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Kcnj4 APN 15 79484579 missense probably benign 0.01
IGL02263:Kcnj4 APN 15 79485787 utr 5 prime probably benign
IGL02551:Kcnj4 APN 15 79484902 missense probably benign 0.05
R1305:Kcnj4 UTSW 15 79484819 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1475:Kcnj4 UTSW 15 79484630 missense probably damaging 1.00
R1844:Kcnj4 UTSW 15 79485015 missense probably damaging 1.00
R3906:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3907:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3908:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R4396:Kcnj4 UTSW 15 79484673 missense probably benign 0.06
X0062:Kcnj4 UTSW 15 79485690 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTCGAACGGAGATGACAGCATGG -3'
(R):5'- CAGTGTAACGTCTACTTCGCCAACC -3'

Sequencing Primer
(F):5'- CTGAACAGCAGGGTCTGTG -3'
(R):5'- CGCTACATGGCAGACATCTTC -3'
Posted On2014-03-28