Incidental Mutation 'R1650:Abtb2'
ID174158
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Nameankyrin repeat and BTB (POZ) domain containing 2
Synonyms
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R1650 (G1)
Quality Score200
Status Validated
Chromosome2
Chromosomal Location103566310-103718423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103702402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 515 (V515G)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
Predicted Effect probably damaging
Transcript: ENSMUST00000076212
AA Change: V515G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: V515G

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1052:Abtb2 UTSW 2 103705072 missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R3927:Abtb2 UTSW 2 103708218 splice site probably null
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTGTGTCACAGTCACACTC -3'
(R):5'- TAGGATAGCTGCTGGCCTTCCAAC -3'

Sequencing Primer
(F):5'- GTCACACTCACACACCTCTTG -3'
(R):5'- CACTACCATAGTTGTCCAGGAGG -3'
Posted On2014-04-24