Incidental Mutation 'R1650:Phlpp2'
ID174188
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1650 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 109933955 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably benign
Transcript: ENSMUST00000034175
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149990
Predicted Effect probably benign
Transcript: ENSMUST00000179721
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATGAATATGGCTGAATCCCC -3'
(R):5'- AGGTTAAAATGTGACCTCTGCCACC -3'

Sequencing Primer
(F):5'- CCCCTTTTCTTCAGAGATAAAGAGTG -3'
(R):5'- atcctcctgcctctgcc -3'
Posted On2014-04-24