Incidental Mutation 'R1766:Pigk'
ID194348
Institutional Source Beutler Lab
Gene Symbol Pigk
Ensembl Gene ENSMUSG00000039047
Gene Namephosphatidylinositol glycan anchor biosynthesis, class K
Synonyms3000001O05Rik
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152714100-152980408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 152740156 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 135 (L135V)
Ref Sequence ENSEMBL: ENSMUSP00000123772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045029] [ENSMUST00000159899] [ENSMUST00000161596] [ENSMUST00000162642] [ENSMUST00000200224]
Predicted Effect probably damaging
Transcript: ENSMUST00000045029
AA Change: L135V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045351
Gene: ENSMUSG00000039047
AA Change: L135V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 183 2.4e-25 PFAM
Pfam:Peptidase_C13 203 353 2.2e-17 PFAM
transmembrane domain 411 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159045
Predicted Effect probably damaging
Transcript: ENSMUST00000159899
AA Change: L135V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123772
Gene: ENSMUSG00000039047
AA Change: L135V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 306 1.6e-47 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161596
AA Change: L135V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123753
Gene: ENSMUSG00000039047
AA Change: L135V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 306 5.5e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162642
AA Change: L135V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123899
Gene: ENSMUSG00000039047
AA Change: L135V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 306 1.5e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162835
Predicted Effect probably benign
Transcript: ENSMUST00000200224
SMART Domains Protein: ENSMUSP00000142966
Gene: ENSMUSG00000039047

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine protease family C13 that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is a member of the multisubunit enzyme, GPI transamidase and is thought to be its enzymatic component. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Pigk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pigk APN 3 152747632 nonsense probably null
IGL00668:Pigk APN 3 152742536 missense possibly damaging 0.50
IGL01335:Pigk APN 3 152742536 missense probably benign 0.30
IGL01657:Pigk APN 3 152722520 missense probably damaging 1.00
IGL01813:Pigk APN 3 152742519 missense probably damaging 1.00
IGL02426:Pigk APN 3 152742483 splice site probably null
IGL02871:Pigk APN 3 152766516 missense probably damaging 1.00
IGL02963:Pigk APN 3 152766461 nonsense probably null
R0135:Pigk UTSW 3 152744706 splice site probably benign
R1750:Pigk UTSW 3 152744464 missense probably damaging 1.00
R1990:Pigk UTSW 3 152744494 missense probably damaging 1.00
R1991:Pigk UTSW 3 152744494 missense probably damaging 1.00
R2010:Pigk UTSW 3 152766514 missense probably damaging 1.00
R2864:Pigk UTSW 3 152722552 missense probably damaging 1.00
R3883:Pigk UTSW 3 152714195 missense probably benign 0.00
R4153:Pigk UTSW 3 152740129 missense probably damaging 1.00
R4730:Pigk UTSW 3 152742566 nonsense probably null
R4911:Pigk UTSW 3 152740204 missense probably damaging 1.00
R4942:Pigk UTSW 3 152744517 missense probably damaging 1.00
R5323:Pigk UTSW 3 152738200 missense probably damaging 1.00
R5655:Pigk UTSW 3 152740221 missense probably damaging 1.00
R5941:Pigk UTSW 3 152766513 missense possibly damaging 0.94
R5986:Pigk UTSW 3 152740849 missense probably benign 0.00
R6391:Pigk UTSW 3 152740849 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCATGTCCTCTTGTGTGACTAATC -3'
(R):5'- AGCATCTGTTTACCGGGTTCCATTTG -3'

Sequencing Primer
(F):5'- cccttctcttgcctcagtc -3'
(R):5'- CGGGTTCCATTTGATCATGTTTC -3'
Posted On2014-05-23