Incidental Mutation 'R1467:Hoxb9'
ID197635
Institutional Source Beutler Lab
Gene Symbol Hoxb9
Ensembl Gene ENSMUSG00000020875
Gene Namehomeobox B9
SynonymsHox-2.5
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R1467 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96271457-96276595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96271938 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000000010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000010] [ENSMUST00000174042]
Predicted Effect probably benign
Transcript: ENSMUST00000000010
AA Change: T133A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000010
Gene: ENSMUSG00000020875
AA Change: T133A

DomainStartEndE-ValueType
Pfam:Hox9_act 1 172 2.1e-59 PFAM
HOX 185 247 2.68e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174042
SMART Domains Protein: ENSMUSP00000133919
Gene: ENSMUSG00000020875

DomainStartEndE-ValueType
Pfam:Hox9_act 1 96 5e-42 PFAM
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.9%
  • 20x: 94.1%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded nuclear protein functions as a sequence-specific transcription factor that is involved in cell proliferation and differentiation. Increased expression of this gene is associated with some cases of leukemia, prostate cancer and lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect developing thoracic skeletal elements. Homozygotes exhibit rib fusion, abnormal rib attachment to the sternum, and reduced intercostal segments of the sternum. Homozygotes or heterozygotes may show an eighth rib attached to the sternum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110012J17Rik T C 17: 66,448,327 D340G probably damaging Het
4930430O22Rik T C 5: 115,436,175 probably benign Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
Atg7 T A 6: 114,858,982 probably benign Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Brca1 A T 11: 101,531,107 probably benign Het
Btg3 A G 16: 78,364,800 probably null Het
CAAA01180111.1 C A 9: 124,295,463 V9L possibly damaging Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Clec4e G A 6: 123,285,461 probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
D130052B06Rik C T 11: 33,623,622 probably benign Het
Dlec1 G A 9: 119,128,003 probably benign Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Ganc A T 2: 120,430,928 probably benign Het
Gm872 T A 10: 92,969,763 H1495L probably benign Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Gm9839 T A 1: 32,520,513 R163* probably null Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kifap3 T C 1: 163,829,120 probably benign Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrp1b A T 2: 40,657,356 probably benign Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Nalcn T C 14: 123,464,656 probably benign Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
P3h2 A T 16: 25,965,868 probably benign Het
P4ha2 A G 11: 54,106,410 probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prdm14 C A 1: 13,124,532 probably benign Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Ryr3 G T 2: 112,753,002 probably benign Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Slc5a2 T C 7: 128,271,256 probably benign Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ttll5 A G 12: 85,918,962 probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Hoxb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Hoxb9 APN 11 96274788 nonsense probably null
IGL02251:Hoxb9 APN 11 96274825 missense probably damaging 1.00
IGL02738:Hoxb9 APN 11 96274728 missense possibly damaging 0.87
R1467:Hoxb9 UTSW 11 96271938 missense probably benign
R1958:Hoxb9 UTSW 11 96272054 missense possibly damaging 0.88
R4419:Hoxb9 UTSW 11 96271981 missense probably benign 0.00
R4420:Hoxb9 UTSW 11 96271981 missense probably benign 0.00
R4666:Hoxb9 UTSW 11 96274831 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCGTGCAGCTTCCAGCCCAAAG -3'
(R):5'- CGGCCTCCTACAGTTCTATCGCAG -3'

Sequencing Primer
(F):5'- GAGCCTGCCGTCTGTCTAC -3'
(R):5'- ACTTACTTTGATCCGGCCTC -3'
Posted On2014-05-23