Incidental Mutation 'R0048:Nanos3'
ID201289
Institutional Source Beutler Lab
Gene Symbol Nanos3
Ensembl Gene ENSMUSG00000056155
Gene Namenanos C2HC-type zinc finger 3
Synonymsnos3
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R0048 (G1)
Quality Score68
Status Validated
Chromosome8
Chromosomal Location84173731-84185217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84176134 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 133 (R133Q)
Ref Sequence ENSEMBL: ENSMUSP00000147775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070102] [ENSMUST00000093375] [ENSMUST00000118856] [ENSMUST00000210202]
Predicted Effect probably damaging
Transcript: ENSMUST00000070102
AA Change: R133Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067385
Gene: ENSMUSG00000056155
AA Change: R133Q

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
Pfam:zf-nanos 57 110 1.2e-28 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083549
Predicted Effect probably benign
Transcript: ENSMUST00000093375
SMART Domains Protein: ENSMUSP00000091067
Gene: ENSMUSG00000008129

DomainStartEndE-ValueType
low complexity region 226 241 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102383
Predicted Effect probably benign
Transcript: ENSMUST00000118856
SMART Domains Protein: ENSMUSP00000113651
Gene: ENSMUSG00000008129

DomainStartEndE-ValueType
Pfam:DUF4671 1 193 2.1e-62 PFAM
Pfam:DUF4671 181 600 7.3e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210202
AA Change: R133Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211482
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this locus results in both male and female infertility. Both male and female gonads are reduced in size and are devoid of germ cells, putatively due to impaired maintainence of primordial germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mroh9 G A 1: 163,062,487 T227M probably damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Olfr273 C A 4: 52,856,196 A106S probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Urah C T 7: 140,836,752 T46I probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r67 G A 7: 10,446,866 G19E probably damaging Het
Wdr76 C T 2: 121,535,419 probably benign Het
Wwox C A 8: 114,439,830 P20Q probably damaging Het
Other mutations in Nanos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0047:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0089:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0090:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0102:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0103:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0134:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0145:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0189:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0190:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0226:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0344:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0494:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTGGCAAACAGACATGAAATG -3'
(R):5'- TGCAAACACAATGGCGAGTCCC -3'

Sequencing Primer
(F):5'- TCTCTACTACCCTGTGCAATAAAGG -3'
(R):5'- TCCCATGTCCTGAAGGATGAG -3'
Posted On2014-05-28