Incidental Mutation 'R2066:4933436I01Rik'
ID226719
Institutional Source Beutler Lab
Gene Symbol 4933436I01Rik
Ensembl Gene ENSMUSG00000025288
Gene NameRIKEN cDNA 4933436I01 gene
Synonyms
MMRRC Submission 040071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2066 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location67919864-67921450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67920702 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 184 (I184L)
Ref Sequence ENSEMBL: ENSMUSP00000026325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026325]
Predicted Effect probably benign
Transcript: ENSMUST00000026325
AA Change: I184L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000026325
Gene: ENSMUSG00000025288
AA Change: I184L

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
internal_repeat_1 172 240 2.42e-18 PROSPERO
internal_repeat_1 280 348 2.42e-18 PROSPERO
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bdnf C A 2: 109,723,902 T207K probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 S652P probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cntn6 C T 6: 104,861,822 R946* probably null Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phldb2 A T 16: 45,770,758 L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 I734S possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in 4933436I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:4933436I01Rik APN X 67920604 missense possibly damaging 0.90
R1974:4933436I01Rik UTSW X 67920049 nonsense probably null
R2062:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2063:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2064:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2065:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2068:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R3147:4933436I01Rik UTSW X 67921378 missense probably benign 0.06
R3148:4933436I01Rik UTSW X 67921378 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCTGGTCCTGACTGAGTAG -3'
(R):5'- CAGTATGCTCAGCTACAGAGTG -3'

Sequencing Primer
(F):5'- TCCTGACTGAGTAGTTTGATCTTATC -3'
(R):5'- CCTGATGGAGTGAAGACAA -3'
Posted On2014-09-17