Incidental Mutation 'R2142:Sart3'
ID236355
Institutional Source Beutler Lab
Gene Symbol Sart3
Ensembl Gene ENSMUSG00000018974
Gene Namesquamous cell carcinoma antigen recognized by T cells 3
Synonyms
MMRRC Submission 040145-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R2142 (G1)
Quality Score182
Status Not validated
Chromosome5
Chromosomal Location113742446-113772510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113764093 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 141 (E141G)
Ref Sequence ENSEMBL: ENSMUSP00000019118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000197041]
Predicted Effect probably damaging
Transcript: ENSMUST00000019118
AA Change: E141G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974
AA Change: E141G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196778
Predicted Effect possibly damaging
Transcript: ENSMUST00000197041
AA Change: E141G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143778
Gene: ENSMUSG00000018974
AA Change: E141G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
Blast:HAT 292 323 1e-5 BLAST
HAT 325 357 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199823
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding nuclear protein that is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is found to be an important cellular factor for HIV-1 gene expression and viral replication. It also associates transiently with U6 and U4/U6 snRNPs during the recycling phase of the spliceosome cycle. This encoded protein is thought to be involved in the regulation of mRNA splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in hematopoietic cells exhibit protection against the effects of 5-FU treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,616,675 probably null Het
Adgrb3 G T 1: 25,068,209 P640T probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Angpt2 T C 8: 18,714,140 T129A probably benign Het
Atp6v0a4 T A 6: 38,082,936 K236* probably null Het
Baz1b G A 5: 135,217,275 R526H probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Btnl9 G T 11: 49,170,626 probably null Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cdh8 C A 8: 99,111,693 C505F probably damaging Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Ces1c T A 8: 93,130,840 I38F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Col25a1 A G 3: 130,570,316 H546R probably damaging Het
Crot A T 5: 8,987,780 Y179N possibly damaging Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Ddb1 T C 19: 10,619,126 probably null Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Elf2 A G 3: 51,256,440 V496A probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fbn1 T G 2: 125,412,708 T212P possibly damaging Het
Fuca2 A G 10: 13,505,865 Y174C probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gdf2 A G 14: 33,945,241 T307A probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm266 C T 12: 111,485,181 R197K possibly damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gns G A 10: 121,392,778 R498H probably damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Grk6 T C 13: 55,454,364 W335R probably damaging Het
Helz2 T C 2: 181,231,380 E2379G probably benign Het
Hmx2 A T 7: 131,555,859 D234V probably damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTTCT 1: 135,386,282 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Itpkc A G 7: 27,219,650 V397A possibly damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kdr T C 5: 75,968,423 T188A possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Man1a T C 10: 53,934,998 N338S probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Micall1 T C 15: 79,130,795 Y751H probably damaging Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myh2 A G 11: 67,189,332 E1124G probably damaging Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Nat10 T C 2: 103,731,303 probably null Het
Nipa1 C A 7: 55,997,511 probably null Het
Nrbp1 A G 5: 31,247,929 E287G possibly damaging Het
Nup188 T A 2: 30,336,706 I1165N possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1012 C T 2: 85,759,677 R233H probably benign Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1298 C A 2: 111,645,221 V259L probably benign Het
Olfr1383 A G 11: 49,523,839 I39V probably benign Het
Olfr642 C T 7: 104,050,300 G18D probably damaging Het
Olfr786 A G 10: 129,437,747 K312E probably benign Het
Optc A T 1: 133,903,796 probably null Het
Panx3 G C 9: 37,666,673 S87W probably damaging Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pcdhb11 A G 18: 37,422,123 N169D probably benign Het
Pdzd2 C A 15: 12,406,559 G605V probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Pkhd1 T A 1: 20,523,895 K1331N probably benign Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Pot1a T C 6: 25,750,044 probably null Het
Prb1 T A 6: 132,207,203 Q489L unknown Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psme4 A G 11: 30,820,998 Y782C possibly damaging Het
Rab11fip5 T C 6: 85,337,228 probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Rit2 A G 18: 31,153,713 F140L probably benign Het
Rorc G A 3: 94,389,526 R271Q probably benign Het
Sall3 A T 18: 80,969,831 M1130K probably damaging Het
Serpina9 T C 12: 104,008,309 D195G probably benign Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tarsl2 A T 7: 65,658,897 I272L probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tdpoz3 C T 3: 93,826,899 H294Y probably benign Het
Tigd4 A G 3: 84,594,363 T196A possibly damaging Het
Treh G A 9: 44,681,141 M54I probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uhrf1bp1l A G 10: 89,812,048 D207G probably damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp606 T C 7: 12,479,726 I4T probably damaging Het
Zfp638 T A 6: 83,986,596 N1918K probably damaging Het
Zfp65 G T 13: 67,708,192 H333N probably damaging Het
Other mutations in Sart3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sart3 APN 5 113746669 missense probably benign
IGL01309:Sart3 APN 5 113759250 missense probably damaging 1.00
IGL01844:Sart3 APN 5 113745648 nonsense probably null
IGL02147:Sart3 APN 5 113762943 splice site probably benign
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0268:Sart3 UTSW 5 113752399 missense probably damaging 0.99
R1703:Sart3 UTSW 5 113752219 missense probably benign 0.22
R1704:Sart3 UTSW 5 113746007 missense probably benign 0.14
R1998:Sart3 UTSW 5 113747921 critical splice donor site probably null
R3893:Sart3 UTSW 5 113746636 missense probably benign 0.00
R3895:Sart3 UTSW 5 113752427 nonsense probably null
R4231:Sart3 UTSW 5 113771418 missense probably benign
R5367:Sart3 UTSW 5 113759216 splice site probably null
R5488:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5489:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5668:Sart3 UTSW 5 113745156 unclassified probably null
R5903:Sart3 UTSW 5 113751239 missense probably damaging 0.98
R6046:Sart3 UTSW 5 113755446 missense probably damaging 1.00
R6173:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6215:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6216:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6221:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6222:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6320:Sart3 UTSW 5 113751240 missense probably benign 0.34
R6824:Sart3 UTSW 5 113744539 splice site probably null
R6978:Sart3 UTSW 5 113745746 missense probably damaging 0.97
R7062:Sart3 UTSW 5 113745602 missense possibly damaging 0.49
R7162:Sart3 UTSW 5 113762835 missense probably damaging 1.00
R7165:Sart3 UTSW 5 113745995 missense probably benign 0.01
R7222:Sart3 UTSW 5 113746656 missense probably benign 0.01
R7235:Sart3 UTSW 5 113753642 missense probably damaging 1.00
R7237:Sart3 UTSW 5 113754246 missense possibly damaging 0.70
R7340:Sart3 UTSW 5 113744667 missense probably benign 0.02
X0058:Sart3 UTSW 5 113745928 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGGTACAACAGGCTAAC -3'
(R):5'- TGTGGTGACAACTGCTAAGCC -3'

Sequencing Primer
(F):5'- CAGGCTAACTACACACTTGTTG -3'
(R):5'- GTGACAACTGCTAAGCCATGCTG -3'
Posted On2014-10-01