Incidental Mutation 'R2195:Tnf'
ID 238331
Institutional Source Beutler Lab
Gene Symbol Tnf
Ensembl Gene ENSMUSG00000024401
Gene Name tumor necrosis factor
Synonyms DIF, TNF alpha, TNFalpha, Tnfsf1a, Tnfa, tumor necrosis factor-alpha, TNF-alpha
MMRRC Submission 040197-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2195 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35418357-35420983 bp(-) (GRCm39)
Type of Mutation splice site (4793 bp from exon)
DNA Base Change (assembly) A to G at 35420089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025262] [ENSMUST00000025263] [ENSMUST00000025266] [ENSMUST00000167924] [ENSMUST00000173600]
AlphaFold P06804
Predicted Effect probably null
Transcript: ENSMUST00000025262
SMART Domains Protein: ENSMUSP00000025262
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
TNF 154 305 8.76e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025263
AA Change: I71T

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401
AA Change: I71T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025266
SMART Domains Protein: ENSMUSP00000025266
Gene: ENSMUSG00000024402

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
TNF 60 202 5.38e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167924
AA Change: I71T

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401
AA Change: I71T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173510
Predicted Effect probably null
Transcript: ENSMUST00000173600
SMART Domains Protein: ENSMUSP00000134706
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
TNF 33 184 8.76e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184381
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(20) Spontaneous(2) Chemically induced(1)             
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 72,991,318 (GRCm39) V540E probably benign Het
Cep295 T A 9: 15,243,617 (GRCm39) Q1613L probably damaging Het
Cib3 A T 8: 72,958,257 (GRCm39) I160N probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Coq10b T A 1: 55,100,457 (GRCm39) L47Q probably damaging Het
Impg2 T C 16: 56,080,497 (GRCm39) V767A probably benign Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kmt2e T C 5: 23,707,194 (GRCm39) probably null Het
Marf1 T C 16: 13,929,563 (GRCm39) D1681G probably benign Het
Nid1 G T 13: 13,650,788 (GRCm39) V442L probably damaging Het
Or13a21 T C 7: 139,999,138 (GRCm39) T183A possibly damaging Het
Or8k32 T C 2: 86,369,247 (GRCm39) E2G probably benign Het
Ppfia1 T C 7: 144,069,844 (GRCm39) N363S probably damaging Het
Stxbp2 A G 8: 3,684,615 (GRCm39) probably null Het
Zkscan7 T C 9: 122,724,686 (GRCm39) F552L possibly damaging Het
Other mutations in Tnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
Dome UTSW 17 35,420,650 (GRCm39) missense probably damaging 0.99
Panr1 UTSW 17 35,419,180 (GRCm39) missense probably damaging 1.00
R0783:Tnf UTSW 17 35,420,650 (GRCm39) missense probably damaging 0.99
R0815:Tnf UTSW 17 35,420,120 (GRCm39) unclassified probably benign
R0863:Tnf UTSW 17 35,420,120 (GRCm39) unclassified probably benign
R2570:Tnf UTSW 17 35,419,476 (GRCm39) missense probably damaging 0.99
R4660:Tnf UTSW 17 35,419,156 (GRCm39) missense probably benign 0.00
R6670:Tnf UTSW 17 35,420,800 (GRCm39) missense possibly damaging 0.73
R7319:Tnf UTSW 17 35,419,347 (GRCm39) missense possibly damaging 0.58
R7708:Tnf UTSW 17 35,419,134 (GRCm39) missense possibly damaging 0.63
R8093:Tnf UTSW 17 35,420,072 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTTCCCAGCAAGCATCTATG -3'
(R):5'- TCTGGAAAGATGTGGCCAGG -3'

Sequencing Primer
(F):5'- ATCTATGCACTTAGACCCCTTTC -3'
(R):5'- CACCGCAGAAAGAAGCCGTG -3'
Posted On 2014-10-02