Incidental Mutation 'R2265:Ntmt1'
ID244041
Institutional Source Beutler Lab
Gene Symbol Ntmt1
Ensembl Gene ENSMUSG00000026857
Gene NameN-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms
MMRRC Submission 040265-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R2265 (G1)
Quality Score140
Status Not validated
Chromosome2
Chromosomal Location30807826-30823033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30820460 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 58 (N58K)
Ref Sequence ENSEMBL: ENSMUSP00000123140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041726] [ENSMUST00000041830] [ENSMUST00000127566] [ENSMUST00000128303] [ENSMUST00000129628] [ENSMUST00000129712] [ENSMUST00000138889] [ENSMUST00000152374]
Predicted Effect probably benign
Transcript: ENSMUST00000041726
SMART Domains Protein: ENSMUSP00000043462
Gene: ENSMUSG00000039483

DomainStartEndE-ValueType
Blast:ANK 31 63 3e-7 BLAST
ANK 66 95 1.96e3 SMART
ANK 100 129 1.91e-6 SMART
ANK 134 164 1e0 SMART
ANK 168 203 4.3e0 SMART
Blast:ANK 256 287 1e-11 BLAST
SOCS_box 370 410 1.72e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041830
AA Change: N58K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035303
Gene: ENSMUSG00000026857
AA Change: N58K

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 223 2.3e-99 PFAM
Pfam:Ubie_methyltran 36 178 2.8e-7 PFAM
Pfam:Methyltransf_2 59 190 3.6e-8 PFAM
Pfam:Methyltransf_18 61 168 1.5e-9 PFAM
Pfam:Methyltransf_25 65 161 2.4e-8 PFAM
Pfam:Methyltransf_12 66 163 5.2e-11 PFAM
Pfam:Methyltransf_11 66 165 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126037
Predicted Effect probably benign
Transcript: ENSMUST00000127566
AA Change: N58K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142189
Gene: ENSMUSG00000026857
AA Change: N58K

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 118 6.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128303
AA Change: N58K

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123140
Gene: ENSMUSG00000026857
AA Change: N58K

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 78 1.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128509
Predicted Effect probably benign
Transcript: ENSMUST00000129628
Predicted Effect unknown
Transcript: ENSMUST00000129712
AA Change: T37K
SMART Domains Protein: ENSMUSP00000141222
Gene: ENSMUSG00000026857
AA Change: T37K

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 42 1.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138889
AA Change: T37K
SMART Domains Protein: ENSMUSP00000141905
Gene: ENSMUSG00000026857
AA Change: T37K

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 42 1.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143970
AA Change: N56K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148036
Predicted Effect probably benign
Transcript: ENSMUST00000152374
AA Change: N58K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116760
Gene: ENSMUSG00000026857
AA Change: N58K

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 146 8.7e-65 PFAM
Pfam:Methyltransf_11 66 146 4.7e-7 PFAM
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality and premature death associated with premature aging, decreased body size and weight, skin thinning, liver degeneration, increased sensitivity to oxidative stress and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Aox1 C A 1: 58,081,520 D857E probably damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Ddx4 A G 13: 112,621,276 Y290H probably benign Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr164 A G 16: 19,286,555 Y63H probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Zfp616 T C 11: 74,085,463 Y853H possibly damaging Het
Other mutations in Ntmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
puny UTSW 2 30822365 missense probably damaging 1.00
R2266:Ntmt1 UTSW 2 30820460 missense probably benign 0.24
R2267:Ntmt1 UTSW 2 30820460 missense probably benign 0.24
R2858:Ntmt1 UTSW 2 30822365 missense probably damaging 1.00
R2859:Ntmt1 UTSW 2 30822365 missense probably damaging 1.00
R5363:Ntmt1 UTSW 2 30820648 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTTAGCTCCACGAAGCCC -3'
(R):5'- GCAGAAGTAGTTCCTCACCC -3'

Sequencing Primer
(F):5'- TAGCACTGTCACCCTGTGG -3'
(R):5'- GCAGAAGTAGTTCCTCACCCTCTTG -3'
Posted On2014-10-16