Incidental Mutation 'R2329:2210408I21Rik'
List |< first << previous [record 44 of 10171] next >> last >|
ID245813
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77303325 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 843 (S843R)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect probably benign
Transcript: ENSMUST00000168779
AA Change: S843R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: S843R

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAATGCATCTGAAATGGTCATG -3'
(R):5'- AGCTCATATGCATCAACCTTTG -3'

Sequencing Primer
(F):5'- GCATCTGAAATGGTCATGTTGAATG -3'
(R):5'- GCTCATATGCATCAACCTTTGAAAGC -3'
Posted On2014-10-30