Incidental Mutation 'R0288:Amigo2'
ID24750
Institutional Source Beutler Lab
Gene Symbol Amigo2
Ensembl Gene ENSMUSG00000048218
Gene Nameadhesion molecule with Ig like domain 2
Synonyms
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97244125-97247287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97245679 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 287 (N287K)
Ref Sequence ENSEMBL: ENSMUSP00000155019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053106] [ENSMUST00000059433] [ENSMUST00000229890]
Predicted Effect probably damaging
Transcript: ENSMUST00000053106
AA Change: N287K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059913
Gene: ENSMUSG00000048218
AA Change: N287K

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 39 71 7e-1 SMART
LRR 91 114 2.63e0 SMART
LRR 115 138 6.96e0 SMART
LRR_TYP 139 162 4.47e-3 SMART
LRR 163 186 1.07e0 SMART
LRR 190 214 1.06e2 SMART
LRRCT 227 282 4.74e-3 SMART
IGc2 300 369 9.34e-4 SMART
transmembrane domain 397 419 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059433
SMART Domains Protein: ENSMUSP00000055485
Gene: ENSMUSG00000044250

DomainStartEndE-ValueType
Pfam:PC-Esterase 1 254 5.1e-53 PFAM
low complexity region 295 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226615
Predicted Effect probably damaging
Transcript: ENSMUST00000229890
AA Change: N287K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Amigo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Amigo2 APN 15 97245446 missense possibly damaging 0.84
IGL01451:Amigo2 APN 15 97245226 missense probably benign 0.22
IGL01510:Amigo2 APN 15 97245081 missense probably benign
IGL02496:Amigo2 APN 15 97245613 nonsense probably null
IGL02720:Amigo2 APN 15 97245697 nonsense probably null
R0377:Amigo2 UTSW 15 97246380 missense possibly damaging 0.93
R0696:Amigo2 UTSW 15 97245974 missense probably benign 0.00
R1188:Amigo2 UTSW 15 97245713 missense probably benign 0.37
R1639:Amigo2 UTSW 15 97245998 missense probably benign 0.10
R3076:Amigo2 UTSW 15 97245434 missense probably damaging 0.98
R3837:Amigo2 UTSW 15 97245315 missense probably damaging 0.99
R4378:Amigo2 UTSW 15 97245978 missense possibly damaging 0.69
R5196:Amigo2 UTSW 15 97246061 missense probably damaging 1.00
R5698:Amigo2 UTSW 15 97245726 nonsense probably null
R6191:Amigo2 UTSW 15 97245538 missense probably benign 0.42
R6326:Amigo2 UTSW 15 97245375 missense probably benign 0.00
R6738:Amigo2 UTSW 15 97245464 missense possibly damaging 0.82
R7102:Amigo2 UTSW 15 97245860 missense probably damaging 1.00
R7253:Amigo2 UTSW 15 97245075 missense probably benign 0.03
X0018:Amigo2 UTSW 15 97245893 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCGATACAAGAATATACCCCGGC -3'
(R):5'- AGAGGCATCTACCTTCACGGGAAC -3'

Sequencing Primer
(F):5'- TCAAAGCCAGGGTTCTCTATGAC -3'
(R):5'- CACGGGAACCCATTTGTATG -3'
Posted On2013-04-16