Incidental Mutation 'R2396:Tll1'
ID 248527
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Name tolloid-like
Synonyms Tll-1, b2b2476Clo
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2396 (G1)
Quality Score 203
Status Not validated
Chromosome 8
Chromosomal Location 64467965-64659305 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 64523324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 463 (G463*)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000066166
AA Change: G463*
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: G463*

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,261,356 (GRCm39) W1189* probably null Het
Col4a4 C G 1: 82,484,793 (GRCm39) M491I unknown Het
Col5a1 C A 2: 27,876,741 (GRCm39) D813E unknown Het
Cyp4b1 T C 4: 115,498,843 (GRCm39) Y113C probably benign Het
Dmac1 A G 4: 75,196,458 (GRCm39) F11L unknown Het
Dnah9 G T 11: 65,975,984 (GRCm39) T1355K probably benign Het
Efemp1 G A 11: 28,817,941 (GRCm39) R140Q possibly damaging Het
Elapor2 T C 5: 9,485,395 (GRCm39) L519P possibly damaging Het
Fndc3a T C 14: 72,921,123 (GRCm39) D17G possibly damaging Het
Grm8 C T 6: 27,761,241 (GRCm39) A328T probably damaging Het
Lepr C A 4: 101,590,725 (GRCm39) A101E probably benign Het
Ncapg A G 5: 45,835,715 (GRCm39) N382S probably benign Het
Or10am5 C A 7: 6,517,784 (GRCm39) V215F probably damaging Het
Or5m13b T C 2: 85,754,269 (GRCm39) I219T probably benign Het
Pacs2 G A 12: 113,026,987 (GRCm39) D605N probably damaging Het
Pigb T A 9: 72,922,553 (GRCm39) R11* probably null Het
Prl8a1 C A 13: 27,758,007 (GRCm39) R234L probably benign Het
Spred3 T C 7: 28,866,059 (GRCm39) H80R probably damaging Het
Sptlc3 T C 2: 139,408,506 (GRCm39) I207T probably benign Het
Tm4sf4 T G 3: 57,345,181 (GRCm39) C196G unknown Het
Tmem87a A T 2: 120,234,540 (GRCm39) M1K probably null Het
Tmem92 A G 11: 94,673,233 (GRCm39) L10P probably damaging Het
Trdn A T 10: 33,071,978 (GRCm39) E215V probably damaging Het
Trpm2 A T 10: 77,766,471 (GRCm39) D849E probably benign Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64,469,170 (GRCm39) missense probably benign
IGL00583:Tll1 APN 8 64,658,326 (GRCm39) missense probably benign
IGL00767:Tll1 APN 8 64,524,355 (GRCm39) missense probably damaging 1.00
IGL01061:Tll1 APN 8 64,491,488 (GRCm39) critical splice donor site probably null
IGL01077:Tll1 APN 8 64,523,266 (GRCm39) missense probably benign 0.27
IGL01536:Tll1 APN 8 64,527,323 (GRCm39) missense probably damaging 1.00
IGL02137:Tll1 APN 8 64,469,132 (GRCm39) missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64,507,001 (GRCm39) missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64,470,660 (GRCm39) nonsense probably null
IGL02469:Tll1 APN 8 64,523,314 (GRCm39) missense probably benign 0.41
IGL02504:Tll1 APN 8 64,523,271 (GRCm39) missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64,500,031 (GRCm39) splice site probably benign
IGL02937:Tll1 APN 8 64,658,319 (GRCm39) nonsense probably null
IGL03006:Tll1 APN 8 64,527,251 (GRCm39) splice site probably benign
R0518:Tll1 UTSW 8 64,551,505 (GRCm39) missense probably damaging 1.00
R0521:Tll1 UTSW 8 64,551,505 (GRCm39) missense probably damaging 1.00
R0541:Tll1 UTSW 8 64,491,486 (GRCm39) splice site probably null
R0612:Tll1 UTSW 8 64,524,344 (GRCm39) missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64,527,324 (GRCm39) missense probably damaging 0.99
R0738:Tll1 UTSW 8 64,554,984 (GRCm39) missense probably damaging 1.00
R1454:Tll1 UTSW 8 64,491,524 (GRCm39) missense probably benign
R1619:Tll1 UTSW 8 64,509,307 (GRCm39) missense probably benign 0.25
R1625:Tll1 UTSW 8 64,494,476 (GRCm39) missense probably damaging 1.00
R1654:Tll1 UTSW 8 64,570,937 (GRCm39) critical splice donor site probably null
R1663:Tll1 UTSW 8 64,470,720 (GRCm39) missense probably benign 0.08
R1681:Tll1 UTSW 8 64,538,585 (GRCm39) missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64,554,907 (GRCm39) missense probably damaging 0.99
R1908:Tll1 UTSW 8 64,478,141 (GRCm39) missense probably damaging 0.98
R2118:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2121:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2124:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2360:Tll1 UTSW 8 64,504,435 (GRCm39) missense probably damaging 1.00
R3032:Tll1 UTSW 8 64,551,526 (GRCm39) missense probably damaging 0.96
R3115:Tll1 UTSW 8 64,506,900 (GRCm39) missense probably damaging 1.00
R3889:Tll1 UTSW 8 64,658,258 (GRCm39) missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64,571,048 (GRCm39) missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64,494,545 (GRCm39) missense probably damaging 1.00
R4572:Tll1 UTSW 8 64,509,343 (GRCm39) missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64,504,411 (GRCm39) missense probably benign 0.31
R4811:Tll1 UTSW 8 64,538,507 (GRCm39) missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64,523,233 (GRCm39) missense probably benign 0.00
R4992:Tll1 UTSW 8 64,546,978 (GRCm39) missense probably damaging 0.98
R5061:Tll1 UTSW 8 64,506,983 (GRCm39) missense probably damaging 0.99
R5078:Tll1 UTSW 8 64,546,921 (GRCm39) missense probably damaging 1.00
R5208:Tll1 UTSW 8 64,504,527 (GRCm39) missense probably damaging 0.99
R5283:Tll1 UTSW 8 64,555,000 (GRCm39) missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64,538,522 (GRCm39) missense probably damaging 1.00
R5699:Tll1 UTSW 8 64,570,974 (GRCm39) missense probably damaging 0.98
R5986:Tll1 UTSW 8 64,527,297 (GRCm39) missense probably damaging 0.99
R6019:Tll1 UTSW 8 64,494,525 (GRCm39) missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64,506,925 (GRCm39) nonsense probably null
R6083:Tll1 UTSW 8 64,491,620 (GRCm39) splice site probably null
R6125:Tll1 UTSW 8 64,504,521 (GRCm39) missense probably damaging 1.00
R6222:Tll1 UTSW 8 64,551,568 (GRCm39) missense probably benign 0.18
R6275:Tll1 UTSW 8 64,504,401 (GRCm39) nonsense probably null
R6508:Tll1 UTSW 8 64,551,494 (GRCm39) missense probably damaging 0.99
R6758:Tll1 UTSW 8 64,494,439 (GRCm39) critical splice donor site probably null
R6782:Tll1 UTSW 8 64,524,315 (GRCm39) missense probably benign 0.00
R6848:Tll1 UTSW 8 64,551,544 (GRCm39) missense probably damaging 0.99
R7057:Tll1 UTSW 8 64,554,915 (GRCm39) missense probably damaging 1.00
R7144:Tll1 UTSW 8 64,577,979 (GRCm39) missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64,478,222 (GRCm39) missense probably benign 0.00
R7336:Tll1 UTSW 8 64,478,176 (GRCm39) missense probably damaging 0.98
R7373:Tll1 UTSW 8 64,504,391 (GRCm39) missense probably damaging 0.98
R7626:Tll1 UTSW 8 64,551,268 (GRCm39) splice site probably null
R7687:Tll1 UTSW 8 64,574,526 (GRCm39) nonsense probably null
R7699:Tll1 UTSW 8 64,546,988 (GRCm39) missense probably benign 0.00
R7700:Tll1 UTSW 8 64,546,988 (GRCm39) missense probably benign 0.00
R7765:Tll1 UTSW 8 64,504,483 (GRCm39) missense probably damaging 1.00
R7790:Tll1 UTSW 8 64,478,271 (GRCm39) nonsense probably null
R7954:Tll1 UTSW 8 64,571,568 (GRCm39) missense probably damaging 1.00
R8710:Tll1 UTSW 8 64,577,940 (GRCm39) missense possibly damaging 0.77
R8792:Tll1 UTSW 8 64,538,499 (GRCm39) missense probably damaging 1.00
R9134:Tll1 UTSW 8 64,469,201 (GRCm39) missense possibly damaging 0.91
R9444:Tll1 UTSW 8 64,469,123 (GRCm39) missense probably damaging 1.00
R9539:Tll1 UTSW 8 64,494,457 (GRCm39) missense probably damaging 1.00
X0020:Tll1 UTSW 8 64,470,662 (GRCm39) missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64,500,197 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGTCATTTATAGGGAAC -3'
(R):5'- AGCCCAAGAAATCTTCACAGGG -3'

Sequencing Primer
(F):5'- CTGCTGTCATTTATAGGGAACATGTC -3'
(R):5'- GAAATCTTCACAGGGAATCACAG -3'
Posted On 2014-11-11