Incidental Mutation 'R3020:Chrnb3'
ID 257730
Institutional Source Beutler Lab
Gene Symbol Chrnb3
Ensembl Gene ENSMUSG00000031492
Gene Name cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms Acrb3, 5730417K16Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R3020 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 27858739-27889758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 27886812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 447 (R447H)
Ref Sequence ENSEMBL: ENSMUSP00000078428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060943] [ENSMUST00000079463] [ENSMUST00000211104]
AlphaFold Q8BMN3
Predicted Effect probably benign
Transcript: ENSMUST00000060943
AA Change: R462H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052297
Gene: ENSMUSG00000031492
AA Change: R462H

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 239 2.3e-75 PFAM
Pfam:Neur_chan_memb 246 452 1.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079463
AA Change: R447H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078428
Gene: ENSMUSG00000031492
AA Change: R447H

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 224 1.3e-57 PFAM
Pfam:Neur_chan_memb 231 374 4.3e-48 PFAM
Pfam:Neur_chan_memb 349 437 9.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211104
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperactivity and reflex abnormalities but were otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G A 5: 121,639,446 (GRCm39) S533L possibly damaging Het
Bahd1 C T 2: 118,746,887 (GRCm39) P169S probably damaging Het
Ephb6 T C 6: 41,591,455 (GRCm39) F204S probably damaging Het
Ifnlr1 AGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGA 4: 135,433,041 (GRCm39) probably benign Het
Polr1b A G 2: 128,957,601 (GRCm39) D552G probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Tex15 T C 8: 34,066,698 (GRCm39) F2043L probably damaging Het
Vamp8 A G 6: 72,365,330 (GRCm39) I26T possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Other mutations in Chrnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chrnb3 APN 8 27,875,129 (GRCm39) missense probably benign 0.13
IGL01655:Chrnb3 APN 8 27,884,202 (GRCm39) missense probably damaging 1.00
IGL02124:Chrnb3 APN 8 27,886,832 (GRCm39) unclassified probably benign
IGL02403:Chrnb3 APN 8 27,883,836 (GRCm39) missense probably damaging 1.00
IGL02474:Chrnb3 APN 8 27,883,397 (GRCm39) missense probably damaging 1.00
IGL02903:Chrnb3 APN 8 27,876,834 (GRCm39) missense probably damaging 0.96
R0178:Chrnb3 UTSW 8 27,883,392 (GRCm39) missense probably damaging 1.00
R0736:Chrnb3 UTSW 8 27,875,078 (GRCm39) missense probably benign 0.00
R1695:Chrnb3 UTSW 8 27,883,728 (GRCm39) missense probably damaging 1.00
R2051:Chrnb3 UTSW 8 27,876,839 (GRCm39) missense probably damaging 1.00
R2091:Chrnb3 UTSW 8 27,884,262 (GRCm39) missense probably damaging 1.00
R2313:Chrnb3 UTSW 8 27,883,809 (GRCm39) missense probably damaging 1.00
R3981:Chrnb3 UTSW 8 27,884,034 (GRCm39) missense probably damaging 1.00
R4236:Chrnb3 UTSW 8 27,884,021 (GRCm39) missense probably damaging 1.00
R4276:Chrnb3 UTSW 8 27,883,779 (GRCm39) missense probably damaging 1.00
R4422:Chrnb3 UTSW 8 27,886,761 (GRCm39) missense possibly damaging 0.84
R4515:Chrnb3 UTSW 8 27,875,118 (GRCm39) missense probably damaging 1.00
R4688:Chrnb3 UTSW 8 27,884,147 (GRCm39) missense probably damaging 1.00
R4931:Chrnb3 UTSW 8 27,884,258 (GRCm39) missense probably damaging 0.99
R5164:Chrnb3 UTSW 8 27,884,160 (GRCm39) missense probably damaging 1.00
R6333:Chrnb3 UTSW 8 27,883,355 (GRCm39) missense probably damaging 0.96
R6454:Chrnb3 UTSW 8 27,883,403 (GRCm39) missense probably damaging 1.00
R7070:Chrnb3 UTSW 8 27,883,989 (GRCm39) missense probably damaging 1.00
R8060:Chrnb3 UTSW 8 27,884,588 (GRCm39) missense unknown
R8156:Chrnb3 UTSW 8 27,883,682 (GRCm39) missense probably benign 0.13
R8421:Chrnb3 UTSW 8 27,886,718 (GRCm39) missense probably damaging 1.00
R8884:Chrnb3 UTSW 8 27,883,946 (GRCm39) missense possibly damaging 0.90
R9244:Chrnb3 UTSW 8 27,884,594 (GRCm39) missense unknown
R9459:Chrnb3 UTSW 8 27,883,884 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCTATTTGCAACCCTTGATGAG -3'
(R):5'- TACATCTCTAATGGCAGCCACC -3'

Sequencing Primer
(F):5'- GTTCAGCCTCTTGAGTGAAAGATCC -3'
(R):5'- AGCTCAAACCCACGTTTTCTCAG -3'
Posted On 2015-01-11