Incidental Mutation 'R2877:Atg2b'
ID260633
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Nameautophagy related 2B
Synonyms
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location105616136-105685211 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105664009 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 374 (Y374*)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
Predicted Effect probably null
Transcript: ENSMUST00000041055
AA Change: Y374*
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: Y374*

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221568
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105644916 missense probably benign 0.20
IGL01326:Atg2b APN 12 105622144 missense probably damaging 1.00
IGL02063:Atg2b APN 12 105648322 missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105636440 splice site probably benign
IGL02376:Atg2b APN 12 105645468 missense probably damaging 1.00
IGL02381:Atg2b APN 12 105648348 missense probably damaging 1.00
IGL02434:Atg2b APN 12 105639207 missense probably benign 0.00
IGL02534:Atg2b APN 12 105643267 missense probably damaging 1.00
IGL03011:Atg2b APN 12 105626362 missense probably damaging 0.98
IGL03173:Atg2b APN 12 105658294 missense possibly damaging 0.68
R6669_Atg2b_067 UTSW 12 105671529 missense possibly damaging 0.90
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0511:Atg2b UTSW 12 105617153 missense probably damaging 1.00
R0762:Atg2b UTSW 12 105674970 missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105636508 missense probably benign 0.00
R1029:Atg2b UTSW 12 105635773 missense probably damaging 0.96
R1529:Atg2b UTSW 12 105661133 missense probably benign
R1563:Atg2b UTSW 12 105623488 missense probably damaging 0.99
R1746:Atg2b UTSW 12 105669329 missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105654092 missense probably benign 0.01
R1956:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R1957:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R2272:Atg2b UTSW 12 105638008 missense probably benign 0.00
R2878:Atg2b UTSW 12 105664009 nonsense probably null
R4798:Atg2b UTSW 12 105652629 missense probably benign 0.37
R4836:Atg2b UTSW 12 105646814 missense probably benign
R5007:Atg2b UTSW 12 105643876 splice site probably null
R5042:Atg2b UTSW 12 105621262 missense probably benign 0.01
R5134:Atg2b UTSW 12 105674950 missense probably damaging 0.96
R5212:Atg2b UTSW 12 105646796 missense probably benign 0.00
R5250:Atg2b UTSW 12 105635765 missense probably damaging 1.00
R5307:Atg2b UTSW 12 105658329 missense probably benign 0.17
R5342:Atg2b UTSW 12 105658916 missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105649155 missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105621328 missense probably benign 0.00
R5660:Atg2b UTSW 12 105649124 nonsense probably null
R5903:Atg2b UTSW 12 105639359 missense possibly damaging 0.90
R6018:Atg2b UTSW 12 105661171 missense probably damaging 0.96
R6153:Atg2b UTSW 12 105623482 missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105661092 nonsense probably null
R6584:Atg2b UTSW 12 105657995 missense probably damaging 1.00
R6593:Atg2b UTSW 12 105644848 missense probably damaging 1.00
R6669:Atg2b UTSW 12 105671529 missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105635788 missense probably damaging 1.00
R7003:Atg2b UTSW 12 105654249 missense probably benign 0.01
R7193:Atg2b UTSW 12 105664708 missense probably damaging 1.00
R7387:Atg2b UTSW 12 105622775 missense probably damaging 1.00
X0018:Atg2b UTSW 12 105666697 missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105646785 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CGTCACTGAAGGTCTTCTGTTC -3'
(R):5'- TGCTAGTATGGTCACATTGCC -3'

Sequencing Primer
(F):5'- AAGGTCTTCTGTTCTCCACTGCAAG -3'
(R):5'- CTAGTATGGTCACATTGCCATTGG -3'
Posted On2015-01-23