Incidental Mutation 'R2886:Slc27a5'
ID261047
Institutional Source Beutler Lab
Gene Symbol Slc27a5
Ensembl Gene ENSMUSG00000030382
Gene Namesolute carrier family 27 (fatty acid transporter), member 5
SynonymsVLCSH2, FATP5, FACVL3, VLCS-H2
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R2886 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12988346-12998192 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 12989560 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032539] [ENSMUST00000045810] [ENSMUST00000120903]
Predicted Effect probably benign
Transcript: ENSMUST00000032539
SMART Domains Protein: ENSMUSP00000032539
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 557 1.3e-64 PFAM
Pfam:AMP-binding_C 565 641 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045810
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120903
SMART Domains Protein: ENSMUSP00000112495
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 414 2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133977
SMART Domains Protein: ENSMUSP00000117208
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
Pfam:AMP-binding 1 102 3.3e-8 PFAM
Pfam:AMP-binding 100 195 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155192
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of very long-chain acyl-CoA synthetase (VLCS). It is capable of activating very long-chain fatty-acids containing 24- and 26-carbons. It is expressed in liver and associated with endoplasmic reticulum but not with peroxisomes. Its primary role is in fatty acid elongation or complex lipid synthesis rather than in degradation. This gene has a mouse ortholog. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Cables1 A G 18: 11,939,732 D448G possibly damaging Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kcnq5 A T 1: 21,469,547 Y382* probably null Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Selenon T C 4: 134,543,069 D324G probably null Het
Serpinh1 T C 7: 99,349,021 Y134C probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc5a4b C T 10: 76,075,073 V310M probably damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Slc27a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc27a5 APN 7 12988639 missense probably benign 0.08
IGL00906:Slc27a5 APN 7 12991057 missense probably benign 0.00
IGL01067:Slc27a5 APN 7 12989072 missense probably damaging 1.00
IGL02101:Slc27a5 APN 7 12993343 missense possibly damaging 0.95
IGL02148:Slc27a5 APN 7 12994951 missense probably damaging 0.97
IGL02165:Slc27a5 APN 7 12994948 missense probably damaging 0.99
IGL02324:Slc27a5 APN 7 12997560 missense probably benign 0.00
IGL02879:Slc27a5 APN 7 12995044 splice site probably benign
R1519:Slc27a5 UTSW 7 12988459 splice site probably null
R1662:Slc27a5 UTSW 7 12991246 missense probably damaging 1.00
R1774:Slc27a5 UTSW 7 12997607 nonsense probably null
R2012:Slc27a5 UTSW 7 12997707 missense probably damaging 0.98
R2020:Slc27a5 UTSW 7 12993412 missense probably damaging 1.00
R4234:Slc27a5 UTSW 7 12988443 missense probably benign 0.01
R4855:Slc27a5 UTSW 7 12988633 missense probably benign 0.00
R5126:Slc27a5 UTSW 7 12991320 missense probably damaging 1.00
R5450:Slc27a5 UTSW 7 12994942 missense probably benign 0.04
R5712:Slc27a5 UTSW 7 12998083 unclassified probably benign
R6302:Slc27a5 UTSW 7 12988552 missense probably damaging 1.00
R6346:Slc27a5 UTSW 7 12990972 missense possibly damaging 0.75
R6866:Slc27a5 UTSW 7 12997516 missense probably benign 0.00
R6921:Slc27a5 UTSW 7 12991208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCTTCCTGGTCCAAG -3'
(R):5'- CCATTGGCTGGGTGAAGAGTTC -3'

Sequencing Primer
(F):5'- TTCCTGGTCCAAGGTCAGCAC -3'
(R):5'- GAACTCAGAAATCCGCCT -3'
Posted On2015-01-23