Mutagenetix > Incidental Mutation

Incidental Mutation 'R2886:Itgae'

261061

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

alpha-E1, CD103

MMRRC Submission

040474-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2886 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72981409-73038272 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73031513 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1076 (E1076D)

Ref Sequence

ENSEMBL: ENSMUSP00000006101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140]

AlphaFold

Q60677

Predicted Effect

probably benign
Transcript: ENSMUST00000006101
AA Change: E1076D

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: E1076D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000052140

SMART Domains

Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107

Domain	Start	End	E-Value	Type
low complexity region	61	67	N/A	INTRINSIC
low complexity region	74	89	N/A	INTRINSIC
low complexity region	95	106	N/A	INTRINSIC
low complexity region	357	378	N/A	INTRINSIC
SCOP:d1h8fa_	437	619	1e-8	SMART
DUF3635	664	753	3.83e-45	SMART

Meta Mutation Damage Score

0.1708

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,035,712 (GRCm39)		probably benign	Het
Bicdl2	G	A	17: 23,885,732 (GRCm39)		probably null	Het
Cables1	A	G	18: 12,072,789 (GRCm39)	D448G	possibly damaging	Het
Casq2	A	T	3: 102,051,534 (GRCm39)	N338I	probably damaging	Het
Ccr1l1	T	C	9: 123,777,553 (GRCm39)	N298S	probably damaging	Het
Dnajc17	A	G	2: 119,009,933 (GRCm39)	V231A	probably benign	Het
Ell2	T	C	13: 75,911,904 (GRCm39)	S397P	probably damaging	Het
Gm9966	T	C	7: 95,607,753 (GRCm39)	C25R	unknown	Het
H2-DMa	A	G	17: 34,356,121 (GRCm39)	N41S	probably damaging	Het
Helz2	A	G	2: 180,882,535 (GRCm39)	M86T	probably benign	Het
Il17rd	T	A	14: 26,821,510 (GRCm39)	I268N	probably damaging	Het
Ipcef1	C	T	10: 6,850,641 (GRCm39)	V317M	probably damaging	Het
Kcnq5	A	T	1: 21,539,771 (GRCm39)	Y382*	probably null	Het
Kif21b	G	A	1: 136,075,612 (GRCm39)		probably benign	Het
Lilrb4a	A	T	10: 51,367,709 (GRCm39)	N84Y	probably benign	Het
Mdga2	A	G	12: 66,553,044 (GRCm39)		probably benign	Het
Naca	T	C	10: 127,877,547 (GRCm39)		probably benign	Het
Naif1	C	T	2: 32,344,887 (GRCm39)	P197L	probably benign	Het
Nrk	T	C	X: 137,876,197 (GRCm39)	L466P	probably damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Pkn1	G	A	8: 84,407,867 (GRCm39)	A421V	probably benign	Het
Rusc2	A	G	4: 43,415,456 (GRCm39)	Q254R	probably benign	Het
Ryr1	G	T	7: 28,774,223 (GRCm39)	R2404S	probably damaging	Het
Selenon	T	C	4: 134,270,380 (GRCm39)	D324G	probably null	Het
Serpinh1	T	C	7: 98,998,228 (GRCm39)	Y134C	probably damaging	Het
Serpini2	T	C	3: 75,166,921 (GRCm39)	Y112C	probably damaging	Het
Setx	T	G	2: 29,038,637 (GRCm39)	C1707W	probably damaging	Het
Sit1	C	T	4: 43,483,314 (GRCm39)	R50H	possibly damaging	Het
Slc27a5	T	A	7: 12,723,487 (GRCm39)		probably benign	Het
Slc5a4b	C	T	10: 75,910,907 (GRCm39)	V310M	probably damaging	Het
Smc6	T	C	12: 11,326,294 (GRCm39)	V97A	probably damaging	Het
Ube2frt	A	G	12: 36,140,574 (GRCm39)		probably benign	Het
Usp42	T	C	5: 143,707,384 (GRCm39)		probably benign	Het
Utrn	A	T	10: 12,615,105 (GRCm39)		probably null	Het
Vmn2r82	A	G	10: 79,232,082 (GRCm39)	I694V	probably benign	Het
Vmn2r-ps69	T	C	7: 84,956,832 (GRCm39)		noncoding transcript	Het
Zfpm2	A	G	15: 40,965,719 (GRCm39)	T603A	probably benign	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,036,461 (GRCm39)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,004,520 (GRCm39)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,013,974 (GRCm39)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,010,263 (GRCm39)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,010,204 (GRCm39)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,002,585 (GRCm39)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,006,963 (GRCm39)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,009,010 (GRCm39)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	72,994,720 (GRCm39)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,024,844 (GRCm39)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	72,981,448 (GRCm39)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,009,361 (GRCm39)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,008,947 (GRCm39)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,021,777 (GRCm39)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,009,331 (GRCm39)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,009,029 (GRCm39)	splice site	probably benign
IGL02859:Itgae	APN	11	73,005,693 (GRCm39)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,016,136 (GRCm39)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,004,427 (GRCm39)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,024,680 (GRCm39)	splice site	probably null
IGL03352:Itgae	APN	11	73,022,556 (GRCm39)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,021,825 (GRCm39)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,008,973 (GRCm39)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,014,009 (GRCm39)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,005,733 (GRCm39)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,029,335 (GRCm39)	nonsense	probably null
R1231:Itgae	UTSW	11	73,010,205 (GRCm39)	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73,016,188 (GRCm39)	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73,006,418 (GRCm39)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,036,431 (GRCm39)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,007,988 (GRCm39)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R1915:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R2061:Itgae	UTSW	11	73,009,448 (GRCm39)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,036,395 (GRCm39)	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73,012,763 (GRCm39)	nonsense	probably null
R2680:Itgae	UTSW	11	73,005,752 (GRCm39)	missense	probably damaging	1.00
R3873:Itgae	UTSW	11	73,004,442 (GRCm39)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,002,165 (GRCm39)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,002,960 (GRCm39)	missense	probably benign
R4212:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4213:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4691:Itgae	UTSW	11	73,010,345 (GRCm39)	nonsense	probably null
R4736:Itgae	UTSW	11	73,005,706 (GRCm39)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,021,821 (GRCm39)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,001,382 (GRCm39)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,036,464 (GRCm39)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,002,675 (GRCm39)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,024,734 (GRCm39)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,020,074 (GRCm39)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,036,377 (GRCm39)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,031,583 (GRCm39)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,036,427 (GRCm39)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,022,519 (GRCm39)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,002,228 (GRCm39)	splice site	probably null
R6502:Itgae	UTSW	11	73,036,418 (GRCm39)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,009,322 (GRCm39)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,010,342 (GRCm39)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,002,195 (GRCm39)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,002,184 (GRCm39)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,031,504 (GRCm39)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,012,786 (GRCm39)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,004,457 (GRCm39)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,014,095 (GRCm39)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,029,618 (GRCm39)	missense	probably benign
R7860:Itgae	UTSW	11	73,011,099 (GRCm39)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,024,913 (GRCm39)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,011,210 (GRCm39)	missense	probably benign
R8911:Itgae	UTSW	11	73,004,447 (GRCm39)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,016,089 (GRCm39)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,012,752 (GRCm39)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,006,906 (GRCm39)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,002,629 (GRCm39)	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73,016,182 (GRCm39)	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73,011,171 (GRCm39)	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73,002,202 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1186:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1187:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1188:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1189:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1190:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1191:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1192:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- CTGGAACTGACTGTGGATGGAG -3'
(R):5'- CAGAAGCTCAGGGTCACAAG -3'

Sequencing Primer
(F):5'- CTACAGACTTGTTGCTTGGATAGC -3'
(R):5'- TCACAAGGGCGGTTGGTAG -3'

Posted On

2015-01-23