Incidental Mutation 'R3695:Pkd2l2'
ID268960
Institutional Source Beutler Lab
Gene Symbol Pkd2l2
Ensembl Gene ENSMUSG00000014503
Gene Namepolycystic kidney disease 2-like 2
SynonymsTRPP5, Polycystin - L2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34409423-34442789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34438790 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 614 (N614S)
Ref Sequence ENSEMBL: ENSMUSP00000127257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000040506] [ENSMUST00000166156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014647
AA Change: N614S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503
AA Change: N614S

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040506
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166156
AA Change: N614S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503
AA Change: N614S

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted gene disruption display hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Pkd2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Pkd2l2 APN 18 34417015 missense probably damaging 1.00
IGL01943:Pkd2l2 APN 18 34417036 missense probably damaging 1.00
IGL02039:Pkd2l2 APN 18 34435368 critical splice donor site probably null
IGL02139:Pkd2l2 APN 18 34412715 nonsense probably null
IGL02480:Pkd2l2 APN 18 34438790 missense possibly damaging 0.48
IGL02742:Pkd2l2 APN 18 34416917 nonsense probably null
IGL02818:Pkd2l2 APN 18 34412809 missense probably damaging 0.97
IGL03218:Pkd2l2 APN 18 34430320 missense probably damaging 1.00
IGL03345:Pkd2l2 APN 18 34425089 missense probably damaging 1.00
R0362:Pkd2l2 UTSW 18 34435327 missense probably benign 0.03
R0627:Pkd2l2 UTSW 18 34425102 missense probably damaging 1.00
R0883:Pkd2l2 UTSW 18 34430268 synonymous probably null
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0974:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R1199:Pkd2l2 UTSW 18 34438216 critical splice donor site probably null
R1529:Pkd2l2 UTSW 18 34430702 missense probably damaging 1.00
R1579:Pkd2l2 UTSW 18 34427393 missense possibly damaging 0.49
R2229:Pkd2l2 UTSW 18 34430329 missense probably damaging 1.00
R4058:Pkd2l2 UTSW 18 34428192 missense probably benign 0.22
R4600:Pkd2l2 UTSW 18 34438201 missense probably benign 0.03
R4651:Pkd2l2 UTSW 18 34409836 nonsense probably null
R4652:Pkd2l2 UTSW 18 34409836 nonsense probably null
R5114:Pkd2l2 UTSW 18 34433302 missense probably benign
R5341:Pkd2l2 UTSW 18 34409934 intron probably null
R5686:Pkd2l2 UTSW 18 34425237 missense probably damaging 1.00
R5920:Pkd2l2 UTSW 18 34430773 missense probably benign
R6061:Pkd2l2 UTSW 18 34430689 missense probably damaging 1.00
R6167:Pkd2l2 UTSW 18 34428244 missense probably damaging 1.00
R6217:Pkd2l2 UTSW 18 34414680 missense probably benign 0.03
R6293:Pkd2l2 UTSW 18 34427444 missense probably damaging 1.00
R6572:Pkd2l2 UTSW 18 34438771 missense probably damaging 0.99
R6574:Pkd2l2 UTSW 18 34425081 missense probably damaging 1.00
R6723:Pkd2l2 UTSW 18 34438157 missense probably damaging 0.98
R6941:Pkd2l2 UTSW 18 34416883 missense probably benign 0.02
R6958:Pkd2l2 UTSW 18 34409490 nonsense probably null
R7052:Pkd2l2 UTSW 18 34425159 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAACTTCCTGTAGACTGCCC -3'
(R):5'- GATAGCTGCTTCAGTACATATGCAG -3'

Sequencing Primer
(F):5'- GACTGCCCCAACTACCCTGTG -3'
(R):5'- AGCATTTGCAGGCTGCTACAC -3'
Posted On2015-02-19