Mutagenetix > Incidental Mutation

Incidental Mutation 'R4125:Tcof1'

315383

Institutional Source

Beutler Lab

Gene Symbol

Tcof1

Ensembl Gene

ENSMUSG00000024613

Gene Name

treacle ribosome biogenesis factor 1

Synonyms

treacle

MMRRC Submission

041633-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60946827-60982043 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 60952673 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 898 (A898S)

Ref Sequence

ENSEMBL: ENSMUSP00000134755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]

AlphaFold

O08784

Predicted Effect

unknown
Transcript: ENSMUST00000163446
AA Change: C985F

SMART Domains

Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: C985F

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	322	2.2e-8	PFAM
Pfam:Treacle	321	793	4.6e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	855	874	N/A	INTRINSIC
low complexity region	879	893	N/A	INTRINSIC
low complexity region	916	927	N/A	INTRINSIC
low complexity region	967	977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175934
AA Change: A982S

SMART Domains

Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: A982S

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	153	329	1.6e-12	PFAM
Pfam:Treacle	321	792	6.1e-175	PFAM
Pfam:Treacle	782	936	3.2e-16	PFAM
low complexity region	969	982	N/A	INTRINSIC
low complexity region	1025	1039	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1149	1172	N/A	INTRINSIC
low complexity region	1260	1285	N/A	INTRINSIC
coiled coil region	1306	1335	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000176630
AA Change: A946S

SMART Domains

Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: A946S

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	323	2.5e-8	PFAM
Pfam:Treacle	321	793	5.9e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	843	857	N/A	INTRINSIC
low complexity region	880	891	N/A	INTRINSIC
low complexity region	933	946	N/A	INTRINSIC
low complexity region	989	1003	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1113	1136	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
coiled coil region	1270	1299	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177172
AA Change: A898S

SMART Domains

Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: A898S

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	150	322	1.3e-10	PFAM
Pfam:Treacle	321	506	1.5e-78	PFAM
Pfam:Treacle	498	745	2e-105	PFAM
low complexity region	771	786	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC
low complexity region	941	955	N/A	INTRINSIC
low complexity region	976	990	N/A	INTRINSIC

Meta Mutation Damage Score

0.0755

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam30	T	A	3: 98,068,679 (GRCm39)	C43S	probably damaging	Het
Adamts6	A	T	13: 104,449,412 (GRCm39)	Y274F	probably damaging	Het
Ap2b1	A	G	11: 83,256,471 (GRCm39)		probably null	Het
Atm	A	C	9: 53,361,921 (GRCm39)	L2732R	probably damaging	Het
Bbox1	A	G	2: 110,100,525 (GRCm39)	V224A	probably benign	Het
Bmpr1a	T	C	14: 34,156,690 (GRCm39)	D112G	probably benign	Het
Cdk19	A	G	10: 40,270,391 (GRCm39)	I67V	probably benign	Het
Cds2	A	G	2: 132,139,191 (GRCm39)	T145A	probably benign	Het
Chd9	A	G	8: 91,777,912 (GRCm39)	D2641G	probably damaging	Het
Chn2	G	T	6: 54,249,963 (GRCm39)	R24M	probably damaging	Het
Chuk	T	C	19: 44,088,613 (GRCm39)	I121V	probably null	Het
Ctsr	A	T	13: 61,309,659 (GRCm39)	D183E	probably benign	Het
Elp3	T	C	14: 65,797,630 (GRCm39)	E347G	possibly damaging	Het
Fhip1a	A	G	3: 85,572,690 (GRCm39)	S988P	possibly damaging	Het
Gnas	A	G	2: 174,141,958 (GRCm39)	N709S	possibly damaging	Het
Gramd2b	T	C	18: 56,618,296 (GRCm39)	S199P	probably damaging	Het
Gtf3c1	A	T	7: 125,246,622 (GRCm39)	C1562*	probably null	Het
Ifit1bl1	T	A	19: 34,572,188 (GRCm39)	I90F	probably damaging	Het
Igf2r	A	T	17: 12,921,141 (GRCm39)	H1313Q	possibly damaging	Het
Ighj4	T	C	12: 113,392,176 (GRCm39)		probably benign	Het
Kansl2	G	T	15: 98,429,636 (GRCm39)	P132Q	possibly damaging	Het
Lman1	T	C	18: 66,120,932 (GRCm39)	H430R	possibly damaging	Het
Lrrk2	T	C	15: 91,699,686 (GRCm39)	I2511T	probably benign	Het
Lvrn	C	A	18: 47,010,036 (GRCm39)	P395T	possibly damaging	Het
Myrip	C	A	9: 120,293,764 (GRCm39)	S753*	probably null	Het
Nectin4	A	G	1: 171,213,301 (GRCm39)	S408G	probably benign	Het
Or14j8	A	G	17: 38,263,681 (GRCm39)	I78T	probably benign	Het
Or52ae9	T	C	7: 103,390,207 (GRCm39)	K80R	probably benign	Het
Pcdhb13	T	C	18: 37,576,873 (GRCm39)	I417T	probably damaging	Het
Per2	T	C	1: 91,357,172 (GRCm39)	T664A	possibly damaging	Het
Plec	A	T	15: 76,056,962 (GRCm39)	L4347Q	probably damaging	Het
Poln	A	G	5: 34,261,295 (GRCm39)	S561P	probably benign	Het
Polr1a	T	C	6: 71,942,690 (GRCm39)	F1177L	probably benign	Het
Pramel24	C	T	4: 143,452,850 (GRCm39)	R94*	probably null	Het
Ptprb	A	T	10: 116,189,754 (GRCm39)	R1804S	probably benign	Het
Rhof	C	T	5: 123,257,588 (GRCm39)	V181M	probably damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Slc22a12	T	C	19: 6,588,818 (GRCm39)	E281G	probably damaging	Het
Slco6b1	T	A	1: 96,915,622 (GRCm39)		noncoding transcript	Het
Stac	C	A	9: 111,433,126 (GRCm39)		probably null	Het
Tep1	C	T	14: 51,081,191 (GRCm39)	R1349Q	possibly damaging	Het
Thoc6	A	T	17: 23,888,319 (GRCm39)		probably benign	Het
Tmem179	A	T	12: 112,477,461 (GRCm39)	F8I	possibly damaging	Het
Tnpo3	A	G	6: 29,560,091 (GRCm39)	L684P	probably damaging	Het
Ubash3a	T	C	17: 31,456,249 (GRCm39)	Y506H	probably damaging	Het
Umps	G	A	16: 33,777,288 (GRCm39)	Q431*	probably null	Het
Unc13c	A	G	9: 73,481,289 (GRCm39)		probably null	Het
Vmn1r210	A	T	13: 23,011,779 (GRCm39)	M169K	probably benign	Het
Zfp946	C	T	17: 22,673,548 (GRCm39)	Q101*	probably null	Het

Other mutations in Tcof1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tcof1	APN	18	60,947,640 (GRCm39)	unclassified	probably benign
IGL01339:Tcof1	APN	18	60,951,167 (GRCm39)	utr 3 prime	probably benign
IGL02072:Tcof1	APN	18	60,964,637 (GRCm39)	missense	possibly damaging	0.85
IGL02160:Tcof1	APN	18	60,981,815 (GRCm39)	unclassified	probably benign
IGL02513:Tcof1	APN	18	60,964,850 (GRCm39)	missense	possibly damaging	0.51
IGL02823:Tcof1	APN	18	60,949,120 (GRCm39)	missense	probably benign	0.00
IGL03161:Tcof1	APN	18	60,966,560 (GRCm39)	missense	possibly damaging	0.86
IGL03291:Tcof1	APN	18	60,962,133 (GRCm39)	missense	possibly damaging	0.71
FR4304:Tcof1	UTSW	18	60,968,814 (GRCm39)	unclassified	probably benign
FR4589:Tcof1	UTSW	18	60,961,722 (GRCm39)	critical splice donor site	probably benign
FR4737:Tcof1	UTSW	18	60,961,722 (GRCm39)	critical splice donor site	probably benign
PIT4802001:Tcof1	UTSW	18	60,965,010 (GRCm39)	missense	unknown
R0569:Tcof1	UTSW	18	60,962,107 (GRCm39)	missense	possibly damaging	0.85
R0602:Tcof1	UTSW	18	60,966,605 (GRCm39)	missense	probably damaging	1.00
R0744:Tcof1	UTSW	18	60,978,904 (GRCm39)	missense	probably damaging	1.00
R0782:Tcof1	UTSW	18	60,949,352 (GRCm39)	missense	probably damaging	0.97
R0833:Tcof1	UTSW	18	60,978,904 (GRCm39)	missense	probably damaging	1.00
R0836:Tcof1	UTSW	18	60,978,904 (GRCm39)	missense	probably damaging	1.00
R0885:Tcof1	UTSW	18	60,968,922 (GRCm39)	missense	possibly damaging	0.84
R1465:Tcof1	UTSW	18	60,952,026 (GRCm39)	splice site	probably benign
R1528:Tcof1	UTSW	18	60,948,071 (GRCm39)	nonsense	probably null
R1643:Tcof1	UTSW	18	60,949,300 (GRCm39)	missense	possibly damaging	0.72
R1919:Tcof1	UTSW	18	60,949,156 (GRCm39)	missense	possibly damaging	0.85
R1920:Tcof1	UTSW	18	60,971,927 (GRCm39)	missense	possibly damaging	0.87
R1921:Tcof1	UTSW	18	60,971,927 (GRCm39)	missense	possibly damaging	0.87
R2023:Tcof1	UTSW	18	60,966,605 (GRCm39)	missense	probably damaging	1.00
R2108:Tcof1	UTSW	18	60,968,845 (GRCm39)	missense	probably damaging	0.97
R2114:Tcof1	UTSW	18	60,965,857 (GRCm39)	missense	possibly damaging	0.85
R2115:Tcof1	UTSW	18	60,965,857 (GRCm39)	missense	possibly damaging	0.85
R2116:Tcof1	UTSW	18	60,965,857 (GRCm39)	missense	possibly damaging	0.85
R2117:Tcof1	UTSW	18	60,965,857 (GRCm39)	missense	possibly damaging	0.85
R2156:Tcof1	UTSW	18	60,964,901 (GRCm39)	missense	possibly damaging	0.92
R2221:Tcof1	UTSW	18	60,970,973 (GRCm39)	missense	possibly damaging	0.51
R2229:Tcof1	UTSW	18	60,965,249 (GRCm39)	intron	probably benign
R2913:Tcof1	UTSW	18	60,949,156 (GRCm39)	missense	possibly damaging	0.85
R2914:Tcof1	UTSW	18	60,949,156 (GRCm39)	missense	possibly damaging	0.85
R3944:Tcof1	UTSW	18	60,955,909 (GRCm39)	missense	probably damaging	0.98
R3979:Tcof1	UTSW	18	60,964,605 (GRCm39)	missense	possibly damaging	0.71
R4049:Tcof1	UTSW	18	60,965,975 (GRCm39)	missense	possibly damaging	0.84
R5047:Tcof1	UTSW	18	60,964,986 (GRCm39)	missense	possibly damaging	0.86
R5433:Tcof1	UTSW	18	60,951,105 (GRCm39)	utr 3 prime	probably benign
R5546:Tcof1	UTSW	18	60,964,628 (GRCm39)	missense	possibly damaging	0.85
R5832:Tcof1	UTSW	18	60,952,611 (GRCm39)	missense	unknown
R5965:Tcof1	UTSW	18	60,966,490 (GRCm39)	critical splice donor site	probably null
R6301:Tcof1	UTSW	18	60,961,897 (GRCm39)	missense	probably damaging	0.97
R6480:Tcof1	UTSW	18	60,947,852 (GRCm39)	splice site	probably null
R6910:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R6911:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R7105:Tcof1	UTSW	18	60,976,368 (GRCm39)	missense	probably damaging	1.00
R7225:Tcof1	UTSW	18	60,961,520 (GRCm39)	missense	unknown
R7356:Tcof1	UTSW	18	60,951,166 (GRCm39)	missense	unknown
R7467:Tcof1	UTSW	18	60,964,977 (GRCm39)	missense	unknown
R7536:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R7804:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R7818:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R7863:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8006:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8007:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8008:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8063:Tcof1	UTSW	18	60,971,834 (GRCm39)	missense	probably damaging	1.00
R8192:Tcof1	UTSW	18	60,976,375 (GRCm39)	missense	probably damaging	1.00
R8200:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8203:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8204:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8207:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8217:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8300:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8517:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8518:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8553:Tcof1	UTSW	18	60,964,643 (GRCm39)	missense	possibly damaging	0.92
R8729:Tcof1	UTSW	18	60,962,145 (GRCm39)	missense	unknown
R8732:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R8749:Tcof1	UTSW	18	60,962,123 (GRCm39)	missense	possibly damaging	0.84
R9800:Tcof1	UTSW	18	60,949,558 (GRCm39)	missense	unknown
RF001:Tcof1	UTSW	18	60,968,811 (GRCm39)	unclassified	probably benign
RF007:Tcof1	UTSW	18	60,966,640 (GRCm39)	small insertion	probably benign
RF009:Tcof1	UTSW	18	60,968,815 (GRCm39)	unclassified	probably benign
RF010:Tcof1	UTSW	18	60,968,816 (GRCm39)	unclassified	probably benign
RF011:Tcof1	UTSW	18	60,968,811 (GRCm39)	unclassified	probably benign
RF013:Tcof1	UTSW	18	60,968,815 (GRCm39)	unclassified	probably benign
RF015:Tcof1	UTSW	18	60,966,656 (GRCm39)	small insertion	probably benign
RF016:Tcof1	UTSW	18	60,966,647 (GRCm39)	small insertion	probably benign
RF022:Tcof1	UTSW	18	60,968,807 (GRCm39)	unclassified	probably benign
RF024:Tcof1	UTSW	18	60,968,810 (GRCm39)	unclassified	probably benign
RF027:Tcof1	UTSW	18	60,968,808 (GRCm39)	unclassified	probably benign
RF029:Tcof1	UTSW	18	60,968,807 (GRCm39)	unclassified	probably benign
RF029:Tcof1	UTSW	18	60,968,817 (GRCm39)	unclassified	probably benign
RF030:Tcof1	UTSW	18	60,968,795 (GRCm39)	unclassified	probably benign
RF030:Tcof1	UTSW	18	60,966,646 (GRCm39)	small insertion	probably benign
RF030:Tcof1	UTSW	18	60,966,640 (GRCm39)	small insertion	probably benign
RF031:Tcof1	UTSW	18	60,968,817 (GRCm39)	unclassified	probably benign
RF031:Tcof1	UTSW	18	60,966,637 (GRCm39)	small insertion	probably benign
RF035:Tcof1	UTSW	18	60,966,625 (GRCm39)	small insertion	probably benign
RF036:Tcof1	UTSW	18	60,968,808 (GRCm39)	unclassified	probably benign
RF036:Tcof1	UTSW	18	60,961,480 (GRCm39)	small insertion	probably benign
RF038:Tcof1	UTSW	18	60,966,638 (GRCm39)	small insertion	probably benign
RF040:Tcof1	UTSW	18	60,966,655 (GRCm39)	small insertion	probably benign
RF040:Tcof1	UTSW	18	60,961,480 (GRCm39)	small insertion	probably benign
RF041:Tcof1	UTSW	18	60,966,648 (GRCm39)	small insertion	probably benign
RF041:Tcof1	UTSW	18	60,966,644 (GRCm39)	small insertion	probably benign
RF043:Tcof1	UTSW	18	60,966,644 (GRCm39)	small insertion	probably benign
RF050:Tcof1	UTSW	18	60,966,651 (GRCm39)	small insertion	probably benign
RF051:Tcof1	UTSW	18	60,966,651 (GRCm39)	small insertion	probably benign
RF053:Tcof1	UTSW	18	60,968,819 (GRCm39)	unclassified	probably benign
RF056:Tcof1	UTSW	18	60,966,647 (GRCm39)	small insertion	probably benign
RF057:Tcof1	UTSW	18	60,966,638 (GRCm39)	small insertion	probably benign
RF057:Tcof1	UTSW	18	60,966,637 (GRCm39)	small insertion	probably benign
RF057:Tcof1	UTSW	18	60,966,636 (GRCm39)	small insertion	probably benign
RF057:Tcof1	UTSW	18	60,966,643 (GRCm39)	small insertion	probably benign
RF060:Tcof1	UTSW	18	60,968,816 (GRCm39)	unclassified	probably benign
RF060:Tcof1	UTSW	18	60,968,819 (GRCm39)	unclassified	probably benign
RF063:Tcof1	UTSW	18	60,966,645 (GRCm39)	small insertion	probably benign
RF064:Tcof1	UTSW	18	60,966,646 (GRCm39)	small insertion	probably benign
RF064:Tcof1	UTSW	18	60,966,643 (GRCm39)	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTGGGGTCTCTTGGCATC -3'
(R):5'- TGAAAGGCCAGCATGGTTGTG -3'

Sequencing Primer
(F):5'- TCCTCCTCGTCCTCGGAAGAAG -3'
(R):5'- TGTGTGTAGTCAGCAGCCC -3'

Posted On

2015-05-14