Incidental Mutation 'R4173:Trav6d-3'
ID318220
Institutional Source Beutler Lab
Gene Symbol Trav6d-3
Ensembl Gene ENSMUSG00000096600
Gene NameT cell receptor alpha variable 6D-3
Synonyms
MMRRC Submission 041012-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4173 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52725299-52726917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52725349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 14 (I14M)
Ref Sequence ENSEMBL: ENSMUSP00000137760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181483] [ENSMUST00000184883]
Predicted Effect probably benign
Transcript: ENSMUST00000181483
AA Change: I14M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137760
Gene: ENSMUSG00000096600
AA Change: I14M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set 21 112 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184883
SMART Domains Protein: ENSMUSP00000139137
Gene: ENSMUSG00000096600

DomainStartEndE-ValueType
Pfam:V-set 11 102 3.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdk1 T C 10: 69,345,161 D73G probably benign Het
Cspg4 A G 9: 56,887,930 E983G probably damaging Het
Gnmt A G 17: 46,726,121 V217A probably damaging Het
Myo5c A G 9: 75,246,258 E142G probably damaging Het
Nr1h5 C T 3: 102,952,230 R171H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Opcml C T 9: 28,903,358 T302I probably benign Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Pigl T A 11: 62,458,511 F18I probably benign Het
Pip4k2b T C 11: 97,722,375 K265R probably benign Het
Rora C A 9: 68,653,910 T35K probably benign Het
Serpinb9e A G 13: 33,255,158 N189S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc25a45 C A 19: 5,880,583 Y99* probably null Het
Smgc T C 15: 91,860,561 S655P possibly damaging Het
Thbs2 A C 17: 14,681,631 probably null Het
Timd2 T C 11: 46,670,960 T286A probably benign Het
Trim28 A G 7: 13,029,878 D622G probably benign Het
Txnl4b G A 8: 109,569,074 V37I probably benign Het
Ubr1 C T 2: 120,946,622 probably null Het
Vps13c A G 9: 67,936,313 N1959D probably benign Het
Xkr4 A G 1: 3,216,488 F493S probably damaging Het
Xrn2 T C 2: 147,047,692 V665A probably damaging Het
Other mutations in Trav6d-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2445:Trav6d-3 UTSW 14 52726828 missense probably damaging 1.00
R7215:Trav6d-3 UTSW 14 52725342 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGTGTTACAATAGACCCTAG -3'
(R):5'- GCTTAAATCCCACTTAGAATGGGG -3'

Sequencing Primer
(F):5'- AGTTTCTGTCCACCAGGGG -3'
(R):5'- CCCACTTAGAATGGGGAATAAAATAG -3'
Posted On2015-06-10