Incidental Mutation 'R4248:2700062C07Rik'
ID320509
Institutional Source Beutler Lab
Gene Symbol 2700062C07Rik
Ensembl Gene ENSMUSG00000024273
Gene NameRIKEN cDNA 2700062C07 gene
Synonyms
MMRRC Submission 041064-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R4248 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24470861-24477765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24472956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 36 (N36S)
Ref Sequence ENSEMBL: ENSMUSP00000095251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097646]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097646
AA Change: N36S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095251
Gene: ENSMUSG00000024273
AA Change: N36S

DomainStartEndE-ValueType
Pfam:DUF4674 27 217 3.9e-80 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12b G A 11: 69,163,605 V250I probably benign Het
Armt1 T C 10: 4,439,687 F115L probably benign Het
Cdh9 T C 15: 16,850,388 F536L probably benign Het
Fbxo25 T C 8: 13,939,617 S355P probably damaging Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gapt C A 13: 110,353,755 V125F probably damaging Het
Gucd1 A T 10: 75,509,828 V131E probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hivep2 A G 10: 14,131,555 E1299G probably damaging Het
Hnf4g A G 3: 3,652,849 D342G possibly damaging Het
Kmt2b C T 7: 30,574,064 R2349H probably benign Het
Lama5 C T 2: 180,180,427 R2896Q possibly damaging Het
Moxd2 A C 6: 40,878,999 I552S probably damaging Het
Nkx1-2 TGGTGAGAGGGGGCCGCCTTGGCCCCG TG 7: 132,599,480 probably null Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Onecut3 A G 10: 80,514,129 T486A possibly damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pirb A G 7: 3,719,298 F182S probably damaging Het
Rev1 C T 1: 38,107,648 R34H possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Tep1 T C 14: 50,862,894 H389R possibly damaging Het
Tnfrsf1b G A 4: 145,215,965 A416V probably benign Het
Ust A T 10: 8,518,218 L61Q possibly damaging Het
Vmn2r101 A T 17: 19,589,114 K168N probably damaging Het
Other mutations in 2700062C07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:2700062C07Rik APN 18 24475523 critical splice acceptor site probably null
IGL02217:2700062C07Rik APN 18 24470898 utr 5 prime probably benign
R1108:2700062C07Rik UTSW 18 24477276 missense probably benign 0.09
R1422:2700062C07Rik UTSW 18 24477276 missense probably benign 0.09
R2212:2700062C07Rik UTSW 18 24470920 missense probably damaging 1.00
R4030:2700062C07Rik UTSW 18 24475658 missense probably benign 0.00
R4246:2700062C07Rik UTSW 18 24472956 missense possibly damaging 0.73
R4249:2700062C07Rik UTSW 18 24472956 missense possibly damaging 0.73
R4734:2700062C07Rik UTSW 18 24470904 start codon destroyed probably null 0.86
Predicted Primers PCR Primer
(F):5'- AGTATAGGCCAGTGACCTGC -3'
(R):5'- ACCAGCACACTTGTAGAGTC -3'

Sequencing Primer
(F):5'- AAGGTATATTATTGGCAGTTTGCTC -3'
(R):5'- CCAGCACACTTGTAGAGTCTTTATAC -3'
Posted On2015-06-12