Mutagenetix > Incidental Mutation

Incidental Mutation 'R4279:Pls3'

322825

Institutional Source

Beutler Lab

Gene Symbol

Pls3

Ensembl Gene

ENSMUSG00000016382

Gene Name

plastin 3 (T-isoform)

Synonyms

T-fimbrin

MMRRC Submission

041079-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R4279 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

74829260-74918788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74846138 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 192 (I192N)

Ref Sequence

ENSEMBL: ENSMUSP00000118995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033547] [ENSMUST00000114057] [ENSMUST00000114058] [ENSMUST00000114059] [ENSMUST00000137192]

AlphaFold

Q99K51

Predicted Effect

probably benign
Transcript: ENSMUST00000033547
AA Change: I192N

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000033547
Gene: ENSMUSG00000016382
AA Change: I192N

Domain	Start	End	E-Value	Type
EFh	16	44	1.92e-3	SMART
EFh	56	84	6.01e-5	SMART
CH	125	237	2.59e-27	SMART
CH	269	376	2.36e-21	SMART
CH	399	504	3.63e-22	SMART
CH	520	625	3.02e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114057
AA Change: I192N

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109691
Gene: ENSMUSG00000016382
AA Change: I192N

Domain	Start	End	E-Value	Type
EFh	16	44	1.92e-3	SMART
EFh	56	84	6.01e-5	SMART
CH	125	237	2.59e-27	SMART
CH	269	376	2.36e-21	SMART
CH	399	504	3.63e-22	SMART
CH	520	625	3.02e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114058
AA Change: I192N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000109692
Gene: ENSMUSG00000016382
AA Change: I192N

Domain	Start	End	E-Value	Type
EFh	16	44	1.92e-3	SMART
EFh	56	84	6.01e-5	SMART
CH	125	237	2.59e-27	SMART
CH	269	385	1.83e-18	SMART
CH	408	513	3.63e-22	SMART
CH	529	634	3.02e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114059
AA Change: I192N

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109693
Gene: ENSMUSG00000016382
AA Change: I192N

Domain	Start	End	E-Value	Type
EFh	16	44	1.92e-3	SMART
EFh	56	84	6.01e-5	SMART
CH	125	237	2.59e-27	SMART
CH	269	376	2.36e-21	SMART
CH	399	504	3.63e-22	SMART
CH	520	625	3.02e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137192
AA Change: I192N

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118995
Gene: ENSMUSG00000016382
AA Change: I192N

Domain	Start	End	E-Value	Type
EFh	16	44	1.92e-3	SMART
EFh	56	84	6.01e-5	SMART
CH	125	237	2.59e-27	SMART
CH	269	376	2.36e-21	SMART
CH	399	504	3.63e-22	SMART
CH	520	625	3.02e-19	SMART

Meta Mutation Damage Score

0.1171

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	T	A	15: 96,269,637 (GRCm39)	L1250Q	probably damaging	Het
Ccdc73	A	T	2: 104,815,355 (GRCm39)	N364Y	possibly damaging	Het
Ccl25	T	A	8: 4,399,829 (GRCm39)	L56Q	probably damaging	Het
Ctnnd2	C	A	15: 30,905,966 (GRCm39)	A871E	probably damaging	Het
Cyp2b23	C	T	7: 26,365,452 (GRCm39)	S461N	possibly damaging	Het
Dgat2	C	A	7: 98,813,912 (GRCm39)	G120V	probably damaging	Het
Dsp	A	T	13: 38,369,207 (GRCm39)	I768F	probably damaging	Het
Dzank1	T	C	2: 144,333,765 (GRCm39)	E356G	probably benign	Het
Fam120a	A	T	13: 49,042,734 (GRCm39)	V889D	probably benign	Het
Fxyd5	C	A	7: 30,734,811 (GRCm39)	D139Y	probably null	Het
Gcnt2	T	C	13: 41,041,666 (GRCm39)	V275A	probably benign	Het
Gimap4	A	G	6: 48,667,511 (GRCm39)	I89V	probably benign	Het
Gm6578	G	A	6: 12,100,187 (GRCm39)		noncoding transcript	Het
Jmjd8	A	G	17: 26,048,787 (GRCm39)		probably benign	Het
Jmy	G	C	13: 93,635,390 (GRCm39)	P142R	probably damaging	Het
Jmy	C	A	13: 93,635,781 (GRCm39)	D12Y	probably damaging	Het
Kif13b	G	T	14: 65,016,805 (GRCm39)	A1324S	probably damaging	Het
Klhl31	T	C	9: 77,563,121 (GRCm39)	S629P	unknown	Het
Lpar1	A	G	4: 58,487,115 (GRCm39)	V52A	possibly damaging	Het
Lrp5	A	G	19: 3,641,778 (GRCm39)	S1395P	possibly damaging	Het
Mogs	T	C	6: 83,093,048 (GRCm39)	L132P	probably damaging	Het
Ncam1	C	A	9: 49,418,259 (GRCm39)		probably benign	Het
Ndufs8	A	T	19: 3,961,014 (GRCm39)	F88I	probably damaging	Het
Nos2	T	A	11: 78,820,602 (GRCm39)	L69Q	probably benign	Het
Or51a6	T	A	7: 102,604,292 (GRCm39)	Q179L	probably benign	Het
Psmd6	T	C	14: 14,112,297 (GRCm38)	N388S	possibly damaging	Het
Rrbp1	T	C	2: 143,805,028 (GRCm39)	T1046A	probably benign	Het
Scn11a	T	C	9: 119,583,428 (GRCm39)	E1729G	probably benign	Het
Slc6a3	A	G	13: 73,692,953 (GRCm39)	D191G	possibly damaging	Het
Slc9a1	T	C	4: 133,139,400 (GRCm39)	F206S	probably benign	Het
Tmc5	A	G	7: 118,273,886 (GRCm39)	*968W	probably null	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Unc13a	T	C	8: 72,119,311 (GRCm39)	K9R	probably damaging	Het
Vegfa	A	G	17: 46,342,392 (GRCm39)	V142A	probably benign	Het
Vmn1r119	T	A	7: 20,745,786 (GRCm39)	M199L	probably benign	Het
Vnn1	A	T	10: 23,774,410 (GRCm39)	D151V	possibly damaging	Het
Zfp365	A	T	10: 67,733,431 (GRCm39)	F254I	probably benign	Het

Other mutations in Pls3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Pls3	APN	X	74,837,874 (GRCm39)	missense	probably damaging	1.00
IGL02025:Pls3	APN	X	74,840,101 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTGAACTTCTCCAACAAGACC -3'
(R):5'- GACCATTCATGAAGATGTATTCAAGTG -3'

Sequencing Primer
(F):5'- CCACAACCGCAAGCCTTTCTG -3'
(R):5'- ACATGCTCTAGTGCTGAGAC -3'

Posted On

2015-06-20