Incidental Mutation 'R4388:2210408I21Rik'
List |< first << previous [record 32 of 9592] next >> last >|
ID326316
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 041125-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4388 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 77316574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect probably null
Transcript: ENSMUST00000168779
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 86% (31/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,709 T218A probably damaging Het
Aldh1l2 T C 10: 83,513,622 D254G probably damaging Het
Arpc4 A G 6: 113,385,497 D36G probably damaging Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cldn20 G A 17: 3,533,210 M219I probably benign Het
Dmxl2 G A 9: 54,396,267 P2308S probably damaging Het
Fancd2 A G 6: 113,556,368 I549V probably damaging Het
Galnt2 T C 8: 124,295,453 probably null Het
Galnt9 A G 5: 110,588,391 D191G probably damaging Het
Gm12666 A T 4: 92,191,114 S157T probably benign Het
Hgf T A 5: 16,614,943 H557Q probably benign Het
Ifna12 T C 4: 88,603,109 D67G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Itih1 A G 14: 30,941,555 V164A possibly damaging Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Kmt2b A C 7: 30,588,590 probably benign Het
Kmt2d C T 15: 98,853,626 probably benign Het
Kng1 T A 16: 23,079,318 H489Q possibly damaging Het
Map4k5 C A 12: 69,845,809 M115I probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Naca T C 10: 128,044,792 S1898P probably damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Pex26 A G 6: 121,184,392 D43G probably damaging Het
Prr14l A G 5: 32,829,254 S966P probably damaging Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Serpina3n C A 12: 104,411,357 Q290K probably benign Het
Sft2d1 A G 17: 8,320,637 K91E possibly damaging Het
Slc25a16 T C 10: 62,928,326 V54A probably benign Het
Svep1 A G 4: 58,069,249 Y2846H possibly damaging Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Uty A G Y: 1,151,956 S795P possibly damaging Het
Xrcc5 T A 1: 72,330,030 S348T possibly damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCACTGATGGACTCTG -3'
(R):5'- AGGCAAGCTCATGTGAATTCTG -3'

Sequencing Primer
(F):5'- ACTCTGTAAAGGACACTGTGC -3'
(R):5'- GTACAGTGCTCAGTCCTGAAATC -3'
Posted On2015-07-06