Incidental Mutation 'R4501:Pusl1'
ID331803
Institutional Source Beutler Lab
Gene Symbol Pusl1
Ensembl Gene ENSMUSG00000051557
Gene Namepseudouridylate synthase-like 1
Synonyms
MMRRC Submission 041753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4501 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155887879-155891781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155889542 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000095344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000079031] [ENSMUST00000097737] [ENSMUST00000105584] [ENSMUST00000120794] [ENSMUST00000156460]
Predicted Effect probably benign
Transcript: ENSMUST00000030901
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097737
AA Change: T252A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095344
Gene: ENSMUSG00000051557
AA Change: T252A

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 16 124 2.5e-12 PFAM
Pfam:PseudoU_synth_1 168 285 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120794
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150446
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,686,587 V65A probably damaging Het
Ankrd28 A G 14: 31,706,796 L956S probably damaging Het
Atp2a1 G A 7: 126,453,383 T388I probably benign Het
AU018091 A G 7: 3,159,079 V389A probably benign Het
Cdh2 A G 18: 16,629,585 V434A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dnah2 T A 11: 69,477,659 M1717L probably benign Het
Dusp6 T A 10: 99,264,595 L151Q probably benign Het
Hc A T 2: 34,997,476 probably null Het
Hmcn1 A T 1: 150,633,666 S3644T probably damaging Het
Kcnt2 T C 1: 140,552,980 I761T probably damaging Het
Mmd2 A G 5: 142,575,210 V90A probably benign Het
Ncf2 C G 1: 152,835,033 Q432E probably benign Het
Nxn T C 11: 76,274,612 E172G probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Phldb3 A G 7: 24,612,561 E100G probably benign Het
Pidd1 A G 7: 141,441,443 probably benign Het
Pldi G T 10: 60,928,409 noncoding transcript Het
Plk5 T C 10: 80,359,471 C208R probably benign Het
Ptpn12 G T 5: 21,019,280 A105E probably damaging Het
Rpl13a T C 7: 45,126,140 H95R probably benign Het
Sh3d21 GAATCTCCTGGGAAAATC GAATC 4: 126,162,859 probably null Het
Slc30a4 A G 2: 122,685,216 I370T probably benign Het
Taf1c A G 8: 119,599,429 F565L probably damaging Het
Tdrd9 A G 12: 112,042,809 K1050E probably benign Het
Tnrc6c T A 11: 117,722,498 L494Q probably damaging Het
Ttn T A 2: 76,794,647 I13450L possibly damaging Het
Usp34 C A 11: 23,401,529 P1439Q probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn1r80 A G 7: 12,193,391 N143D probably benign Het
Zbtb44 G A 9: 31,054,166 V291I probably damaging Het
Other mutations in Pusl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Pusl1 APN 4 155889713 missense probably damaging 0.96
IGL02056:Pusl1 APN 4 155890572 missense probably benign 0.05
R4377:Pusl1 UTSW 4 155890580 missense probably benign
R4893:Pusl1 UTSW 4 155889541 missense probably benign 0.20
R4911:Pusl1 UTSW 4 155891442 unclassified probably benign
R6029:Pusl1 UTSW 4 155889463 missense probably damaging 1.00
R6155:Pusl1 UTSW 4 155890548 missense probably damaging 0.96
R6732:Pusl1 UTSW 4 155891116 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGTGGGCTTTGACTGCATC -3'
(R):5'- CAAAGCTGTCTGTGTTCCTAGG -3'

Sequencing Primer
(F):5'- GGGCTTTGACTGCATCCAAAAGTC -3'
(R):5'- TCCTAGGAGGCTGCAGTTC -3'
Posted On2015-07-21