Incidental Mutation 'R4566:Or52ac1'
ID 343321
Institutional Source Beutler Lab
Gene Symbol Or52ac1
Ensembl Gene ENSMUSG00000051182
Gene Name olfactory receptor family 52 subfamily AC member 1
Synonyms GA_x6K02T2PBJ9-7224628-7223702, Olfr655, MOR38-1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4566 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104245460-104246386 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 104245823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 188 (C188*)
Ref Sequence ENSEMBL: ENSMUSP00000150891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057385] [ENSMUST00000215538] [ENSMUST00000216750]
AlphaFold E9Q252
Predicted Effect probably null
Transcript: ENSMUST00000057385
AA Change: C188*
SMART Domains Protein: ENSMUSP00000054108
Gene: ENSMUSG00000051182
AA Change: C188*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-95 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5e-10 PFAM
Pfam:7tm_1 41 291 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215434
Predicted Effect probably null
Transcript: ENSMUST00000215538
AA Change: C188*
Predicted Effect probably null
Transcript: ENSMUST00000216750
AA Change: C188*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,567,927 (GRCm39) E5082G probably damaging Het
Apol7a A T 15: 77,273,951 (GRCm39) Y170* probably null Het
Cfhr1 T A 1: 139,481,386 (GRCm39) I165F possibly damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Espnl C A 1: 91,272,301 (GRCm39) P510T possibly damaging Het
Fbxw4 A G 19: 45,580,225 (GRCm39) V258A probably benign Het
Foxq1 T C 13: 31,743,471 (GRCm39) M191T probably benign Het
Gabrg1 A T 5: 70,999,484 (GRCm39) L22I probably benign Het
Limk1 A G 5: 134,715,537 (GRCm39) L38P probably benign Het
Mfhas1 C T 8: 36,058,203 (GRCm39) R893C probably damaging Het
Mug2 G A 6: 122,056,597 (GRCm39) V1181I probably benign Het
Pithd1 A G 4: 135,704,548 (GRCm39) V56A probably damaging Het
Plxna4 T C 6: 32,494,338 (GRCm39) K93E probably benign Het
Ppp2cb T C 8: 34,100,723 (GRCm39) V48A possibly damaging Het
Rasl2-9 AGG A 7: 5,128,374 (GRCm39) probably null Het
Rrs1 T C 1: 9,616,452 (GRCm39) F235S probably damaging Het
Rtl1 G A 12: 109,559,293 (GRCm39) L849F probably damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Trps1 A G 15: 50,695,074 (GRCm39) V116A probably damaging Het
Vmn2r51 C T 7: 9,836,341 (GRCm39) E147K probably benign Het
Yy1 T A 12: 108,778,889 (GRCm39) I296K probably damaging Het
Other mutations in Or52ac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Or52ac1 APN 7 104,245,741 (GRCm39) missense probably damaging 1.00
IGL03309:Or52ac1 APN 7 104,246,248 (GRCm39) missense probably benign
R0421:Or52ac1 UTSW 7 104,245,929 (GRCm39) missense probably benign 0.00
R1966:Or52ac1 UTSW 7 104,246,008 (GRCm39) missense probably damaging 1.00
R4452:Or52ac1 UTSW 7 104,245,846 (GRCm39) missense probably damaging 0.98
R5445:Or52ac1 UTSW 7 104,246,028 (GRCm39) missense probably damaging 1.00
R5494:Or52ac1 UTSW 7 104,245,932 (GRCm39) missense probably damaging 0.97
R5838:Or52ac1 UTSW 7 104,246,104 (GRCm39) missense probably benign
R6015:Or52ac1 UTSW 7 104,245,915 (GRCm39) missense probably damaging 1.00
R6928:Or52ac1 UTSW 7 104,245,796 (GRCm39) nonsense probably null
R6996:Or52ac1 UTSW 7 104,246,018 (GRCm39) missense probably benign 0.10
R7250:Or52ac1 UTSW 7 104,245,738 (GRCm39) missense probably damaging 1.00
R7268:Or52ac1 UTSW 7 104,246,284 (GRCm39) missense probably benign
R8195:Or52ac1 UTSW 7 104,246,133 (GRCm39) missense probably damaging 1.00
R9198:Or52ac1 UTSW 7 104,245,635 (GRCm39) missense probably damaging 1.00
X0027:Or52ac1 UTSW 7 104,246,295 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATATGGTGGCCGATGC -3'
(R):5'- GTGAGCCACTACGCTACAAC -3'

Sequencing Primer
(F):5'- ACAGTGCAGGTACATAAGTGATG -3'
(R):5'- GCTACAACACAATTTTAAGCCATTC -3'
Posted On 2015-09-24