Incidental Mutation 'R4832:Gabarap'
ID372922
Institutional Source Beutler Lab
Gene Symbol Gabarap
Ensembl Gene ENSMUSG00000018567
Gene Namegamma-aminobutyric acid receptor associated protein
Synonyms
MMRRC Submission 042448-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4832 (G1)
Quality Score200
Status Validated
Chromosome11
Chromosomal Location69991143-69994951 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 69991852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018711] [ENSMUST00000018716] [ENSMUST00000101526] [ENSMUST00000108592] [ENSMUST00000108593] [ENSMUST00000133485] [ENSMUST00000138186] [ENSMUST00000141623]
Predicted Effect probably benign
Transcript: ENSMUST00000018711
SMART Domains Protein: ENSMUSP00000018711
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 116 1.8e-51 PFAM
Pfam:APG12 30 116 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018716
SMART Domains Protein: ENSMUSP00000018716
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 225 241 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 263 286 N/A INTRINSIC
PHD 339 383 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101526
SMART Domains Protein: ENSMUSP00000099064
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 158 174 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 196 219 N/A INTRINSIC
PHD 272 316 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108592
SMART Domains Protein: ENSMUSP00000104233
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 93 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108593
SMART Domains Protein: ENSMUSP00000104234
Gene: ENSMUSG00000018559

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
CPDc 60 212 7.35e-76 SMART
low complexity region 214 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131531
Predicted Effect probably benign
Transcript: ENSMUST00000133485
SMART Domains Protein: ENSMUSP00000117373
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138186
SMART Domains Protein: ENSMUSP00000117635
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 178 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141231
Predicted Effect probably benign
Transcript: ENSMUST00000141623
SMART Domains Protein: ENSMUSP00000137199
Gene: ENSMUSG00000018559

DomainStartEndE-ValueType
CPDc 1 79 6.29e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152226
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,264 V186A possibly damaging Het
1700088E04Rik A T 15: 79,135,209 M198K probably damaging Het
4931406P16Rik T C 7: 34,238,908 probably benign Het
4933402J07Rik A G 8: 87,567,973 K84R probably null Het
9930021J03Rik G T 19: 29,717,216 L1626I possibly damaging Het
A530099J19Rik T A 13: 19,729,670 noncoding transcript Het
Aamdc T C 7: 97,550,566 probably null Het
Abcc9 A G 6: 142,671,556 V594A probably damaging Het
Adamts13 G A 2: 26,989,402 D656N probably benign Het
Adcy10 G T 1: 165,506,644 C122F probably damaging Het
Adi1 A G 12: 28,675,253 M1V probably null Het
Ahnak G A 19: 9,012,460 probably benign Het
Akt1 G T 12: 112,657,087 P313Q probably damaging Het
Ano3 A T 2: 110,667,722 M758K probably damaging Het
Baz2a T A 10: 128,123,130 N1168K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bcap29 A G 12: 31,624,203 I131T probably benign Het
Btnl6 T C 17: 34,513,992 D299G possibly damaging Het
Ccdc66 A G 14: 27,500,567 I73T probably benign Het
Cdh2 A G 18: 16,627,697 S538P probably benign Het
Cfap54 T A 10: 92,967,528 M1551L probably benign Het
Chd2 G A 7: 73,502,125 A243V probably damaging Het
Cntnap1 T A 11: 101,183,019 N665K probably damaging Het
Colgalt2 C T 1: 152,484,998 T262I possibly damaging Het
Cyp24a1 T C 2: 170,496,178 I149V probably benign Het
Cyp2a5 T A 7: 26,835,545 probably null Het
Dab2 A G 15: 6,336,599 probably null Het
Dnah17 T A 11: 118,026,780 I4158F probably damaging Het
Dnm2 G A 9: 21,474,679 probably null Het
Dpp7 A T 2: 25,352,386 probably benign Het
Epha6 T A 16: 59,960,413 I642F probably damaging Het
Erbb4 T C 1: 68,330,238 S415G probably benign Het
Fancd2 A G 6: 113,553,722 T439A probably benign Het
Fat1 G A 8: 45,013,065 V1431M possibly damaging Het
Fhod3 G A 18: 25,090,248 A884T probably benign Het
Fsip2 A G 2: 82,990,171 D5416G possibly damaging Het
Gm11544 C T 11: 94,845,706 noncoding transcript Het
Gnat2 A C 3: 108,100,648 K304Q probably benign Het
Gramd4 C T 15: 86,134,856 A575V probably benign Het
Gtpbp10 G A 5: 5,539,295 A274V possibly damaging Het
Gzmb A G 14: 56,260,222 I187T probably damaging Het
H2-M10.2 G A 17: 36,284,327 T315I probably damaging Het
Haus5 A T 7: 30,657,027 F524I probably damaging Het
Herc1 A G 9: 66,495,971 S4391G probably benign Het
Herc2 T A 7: 56,098,417 L511* probably null Het
Htt T A 5: 34,824,840 C923S probably benign Het
Idua T C 5: 108,669,381 S7P probably benign Het
Ighv16-1 A T 12: 114,068,846 L112Q probably damaging Het
Igkv1-110 A G 6: 68,271,201 K98R probably benign Het
Kif15 G A 9: 123,002,126 probably null Het
Leng9 C A 7: 4,149,030 G216W probably damaging Het
Lrpprc A G 17: 84,707,156 L1306S probably benign Het
Lztfl1 C A 9: 123,715,389 E20D possibly damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Map3k4 C T 17: 12,271,780 E255K probably damaging Het
Megf9 G A 4: 70,534,428 T132M probably damaging Het
Mob4 T C 1: 55,145,252 probably benign Het
Mttp G A 3: 138,116,050 A252V probably benign Het
Mxi1 A G 19: 53,370,314 D226G probably damaging Het
Myh14 A G 7: 44,625,142 S1249P probably benign Het
Mylk G A 16: 34,922,367 G1083D probably benign Het
Mylk4 T G 13: 32,721,977 I408L probably benign Het
Nbas A G 12: 13,483,739 S1792G probably benign Het
Nelfb A G 2: 25,209,969 V212A probably damaging Het
Nisch T C 14: 31,177,630 probably benign Het
Nqo1 C G 8: 107,388,845 D267H probably benign Het
Olfr1037 C A 2: 86,084,846 L310F probably benign Het
Pcid2 T A 8: 13,085,425 I195F probably damaging Het
Pcnx2 A T 8: 125,752,188 M2107K probably damaging Het
Pgd A T 4: 149,156,591 probably benign Het
Prim2 T C 1: 33,464,064 M430V probably benign Het
Prkaa1 A G 15: 5,160,620 T40A probably damaging Het
Ptges T C 2: 30,903,220 probably benign Het
Ptprn T C 1: 75,258,265 E226G probably benign Het
Rab14 A G 2: 35,189,966 F55S probably damaging Het
Ralgps2 A T 1: 156,857,067 probably benign Het
Rgs11 C T 17: 26,207,568 H258Y probably benign Het
Rhpn2 T C 7: 35,376,349 probably null Het
Rprd2 A T 3: 95,774,171 V452E probably damaging Het
Scube3 C A 17: 28,166,015 H646Q probably damaging Het
Selp A T 1: 164,126,340 I70F probably damaging Het
Sept2 A G 1: 93,499,127 I153V probably damaging Het
Sh3rf3 G A 10: 58,814,083 S170N probably benign Het
Skint4 A T 4: 112,143,766 I353F possibly damaging Het
Slc16a12 A G 19: 34,680,380 I41T possibly damaging Het
Snai2 T C 16: 14,707,017 F129S probably damaging Het
Top3b C T 16: 16,890,662 R629* probably null Het
Trim17 T A 11: 58,971,444 V434E probably damaging Het
Ttn G A 2: 76,784,983 P15051L probably damaging Het
Uggt2 A T 14: 119,001,847 I1391N probably damaging Het
Usp8 A T 2: 126,755,038 M923L probably damaging Het
Vmn1r176 T C 7: 23,835,038 H230R possibly damaging Het
Vmn1r217 C A 13: 23,113,989 D248Y probably damaging Het
Vmn2r14 A T 5: 109,216,110 C647S probably damaging Het
Vwa5b1 A G 4: 138,605,540 I237T probably damaging Het
Zan T A 5: 137,393,161 D4687V unknown Het
Zfp273 T C 13: 67,825,365 V204A probably benign Het
Zfp956 T G 6: 47,952,053 probably benign Het
Other mutations in Gabarap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1480:Gabarap UTSW 11 69991725 missense probably damaging 1.00
R1728:Gabarap UTSW 11 69991689 unclassified probably benign
R1729:Gabarap UTSW 11 69991689 unclassified probably benign
R1730:Gabarap UTSW 11 69991689 unclassified probably benign
R1783:Gabarap UTSW 11 69991689 unclassified probably benign
R1784:Gabarap UTSW 11 69991689 unclassified probably benign
R1785:Gabarap UTSW 11 69991689 unclassified probably benign
R2142:Gabarap UTSW 11 69991689 unclassified probably benign
R4603:Gabarap UTSW 11 69994461 missense probably benign 0.04
R6377:Gabarap UTSW 11 69991804 critical splice donor site probably null
R7331:Gabarap UTSW 11 69994472 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAAGTCTGTTCGTCGAAGCC -3'
(R):5'- TCAAGCTCACTAAGGCCTCTATTC -3'

Sequencing Primer
(F):5'- TGTTCGTCGAAGCCGCCTC -3'
(R):5'- AGGCCTCTATTCTGAGAAATACCCTG -3'
Posted On2016-03-01