Incidental Mutation 'R4300:Cacna1b'
ID 377810
Institutional Source Beutler Lab
Gene Symbol Cacna1b
Ensembl Gene ENSMUSG00000004113
Gene Name calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms alpha(1B), Cav2.2, Cchn1a
MMRRC Submission 041657-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4300 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 24493899-24653164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24525251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1639 (S1639G)
Ref Sequence ENSEMBL: ENSMUSP00000063236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]
AlphaFold O55017
Predicted Effect probably damaging
Transcript: ENSMUST00000041342
AA Change: S1642G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: S1642G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.2e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.1e-47 PFAM
Pfam:PKD_channel 569 715 2.3e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1408 2.7e-52 PFAM
Pfam:Ion_trans 1498 1698 1.2e-59 PFAM
Pfam:PKD_channel 1551 1705 8.1e-9 PFAM
Ca_chan_IQ 1837 1871 1.09e-11 SMART
low complexity region 2040 2050 N/A INTRINSIC
low complexity region 2092 2114 N/A INTRINSIC
low complexity region 2276 2292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070864
AA Change: S1639G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: S1639G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.5e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 848 857 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 915 932 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
Pfam:Ion_trans 1173 1403 1.8e-52 PFAM
Pfam:Ion_trans 1493 1695 5.4e-60 PFAM
Pfam:PKD_channel 1544 1702 4.9e-9 PFAM
Ca_chan_IQ 1798 1832 7.2e-12 SMART
low complexity region 2001 2011 N/A INTRINSIC
low complexity region 2053 2075 N/A INTRINSIC
low complexity region 2237 2253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100348
AA Change: S1643G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: S1643G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 468 5e-68 PDB
Pfam:Ion_trans 517 709 1.2e-47 PFAM
Pfam:PKD_channel 570 716 1.6e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1175 1409 3.2e-52 PFAM
Pfam:Ion_trans 1499 1699 1.4e-59 PFAM
Pfam:PKD_channel 1552 1706 5.6e-9 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102939
AA Change: S1640G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: S1640G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 1e-65 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.6e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1404 1.9e-52 PFAM
Pfam:Ion_trans 1494 1696 5.5e-60 PFAM
Pfam:PKD_channel 1545 1703 5e-9 PFAM
Ca_chan_IQ 1835 1869 1.09e-11 SMART
low complexity region 2038 2048 N/A INTRINSIC
low complexity region 2090 2112 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114447
AA Change: S1643G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: S1643G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 94 367 8.5e-69 PFAM
Pfam:Ion_trans 482 721 2.4e-57 PFAM
Pfam:PKD_channel 571 715 1e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1139 1421 1.3e-62 PFAM
Pfam:Ion_trans 1464 1711 3.2e-64 PFAM
Pfam:PKD_channel 1550 1706 2.7e-9 PFAM
Pfam:GPHH 1713 1783 1.9e-39 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125798
AA Change: S19G
Predicted Effect probably benign
Transcript: ENSMUST00000155356
SMART Domains Protein: ENSMUSP00000116674
Gene: ENSMUSG00000004113

DomainStartEndE-ValueType
Pfam:GPHH 23 93 5.4e-39 PFAM
Meta Mutation Damage Score 0.5744 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,356,675 (GRCm39) R78* probably null Het
A2m G A 6: 121,650,434 (GRCm39) V1181I probably benign Het
Ccs T C 19: 4,884,285 (GRCm39) T56A probably benign Het
Cd177 T C 7: 24,449,845 (GRCm39) I547V possibly damaging Het
Ckmt2 C A 13: 92,011,457 (GRCm39) probably null Het
Cyth1 A G 11: 118,074,720 (GRCm39) F180L probably damaging Het
Dip2c A G 13: 9,660,747 (GRCm39) I840M probably damaging Het
Gm37150 G A 9: 72,292,758 (GRCm39) noncoding transcript Het
Herc1 A G 9: 66,396,688 (GRCm39) D4255G probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnn4 G T 7: 24,077,029 (GRCm39) V193L probably benign Het
Lrrc8d G A 5: 105,961,606 (GRCm39) R672Q probably damaging Het
Mboat2 A G 12: 25,009,082 (GRCm39) N463D probably benign Het
Mtfr1 T A 3: 19,269,621 (GRCm39) probably null Het
Or10g6 A C 9: 39,934,435 (GRCm39) I249L probably benign Het
Or5h24 T C 16: 58,918,641 (GRCm39) Y238C unknown Het
Pcnt G C 10: 76,203,225 (GRCm39) R2626G probably benign Het
Pik3cg A G 12: 32,226,671 (GRCm39) I1072T probably damaging Het
Prc1 G A 7: 79,960,964 (GRCm39) probably benign Het
Psph G T 5: 129,864,529 (GRCm39) probably null Het
Rfx4 T C 10: 84,740,966 (GRCm39) Y601H probably damaging Het
Rmc1 A G 18: 12,321,919 (GRCm39) N513D probably benign Het
Setd5 T G 6: 113,127,123 (GRCm39) V1249G probably damaging Het
Sirpb1b A T 3: 15,613,821 (GRCm39) I87K probably damaging Het
Slc14a2 G A 18: 78,250,283 (GRCm39) R62C probably damaging Het
Spata31 A T 13: 65,067,575 (GRCm39) H79L probably benign Het
Srbd1 C A 17: 86,292,632 (GRCm39) R979L probably damaging Het
Stox2 A T 8: 47,647,027 (GRCm39) Y208* probably null Het
Sun1 A T 5: 139,213,349 (GRCm39) probably benign Het
Tfap4 T C 16: 4,369,224 (GRCm39) D132G probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tubgcp3 G T 8: 12,707,600 (GRCm39) P130T probably damaging Het
Txlnb A G 10: 17,703,673 (GRCm39) E277G probably damaging Het
Other mutations in Cacna1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cacna1b APN 2 24,541,212 (GRCm39) nonsense probably null
IGL00508:Cacna1b APN 2 24,547,301 (GRCm39) critical splice donor site probably null
IGL01085:Cacna1b APN 2 24,569,006 (GRCm39) missense probably damaging 0.98
IGL01310:Cacna1b APN 2 24,575,794 (GRCm39) missense probably damaging 1.00
IGL01361:Cacna1b APN 2 24,569,107 (GRCm39) missense possibly damaging 0.49
IGL01471:Cacna1b APN 2 24,547,304 (GRCm39) missense probably damaging 1.00
IGL01537:Cacna1b APN 2 24,548,540 (GRCm39) missense probably damaging 1.00
IGL01547:Cacna1b APN 2 24,522,047 (GRCm39) unclassified probably benign
IGL01750:Cacna1b APN 2 24,544,407 (GRCm39) missense probably damaging 1.00
IGL01813:Cacna1b APN 2 24,499,902 (GRCm39) missense probably damaging 1.00
IGL01939:Cacna1b APN 2 24,551,769 (GRCm39) missense probably damaging 1.00
IGL01955:Cacna1b APN 2 24,529,149 (GRCm39) missense probably damaging 1.00
IGL01972:Cacna1b APN 2 24,525,107 (GRCm39) critical splice donor site probably null
IGL01987:Cacna1b APN 2 24,587,579 (GRCm39) splice site probably null
IGL02096:Cacna1b APN 2 24,568,927 (GRCm39) missense probably benign 0.01
IGL02111:Cacna1b APN 2 24,497,003 (GRCm39) missense probably damaging 0.96
IGL02254:Cacna1b APN 2 24,506,827 (GRCm39) splice site probably null
IGL03084:Cacna1b APN 2 24,499,944 (GRCm39) missense probably benign
IGL03184:Cacna1b APN 2 24,548,501 (GRCm39) critical splice donor site probably null
IGL03202:Cacna1b APN 2 24,541,124 (GRCm39) missense probably damaging 1.00
IGL03210:Cacna1b APN 2 24,540,584 (GRCm39) missense probably benign 0.00
IGL03402:Cacna1b APN 2 24,652,821 (GRCm39) missense probably damaging 1.00
PIT4283001:Cacna1b UTSW 2 24,521,953 (GRCm39) missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24,648,343 (GRCm39) missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24,648,343 (GRCm39) missense probably damaging 1.00
R0206:Cacna1b UTSW 2 24,497,492 (GRCm39) missense probably damaging 1.00
R0208:Cacna1b UTSW 2 24,497,492 (GRCm39) missense probably damaging 1.00
R0240:Cacna1b UTSW 2 24,528,669 (GRCm39) unclassified probably benign
R0265:Cacna1b UTSW 2 24,651,856 (GRCm39) missense probably damaging 1.00
R0352:Cacna1b UTSW 2 24,515,244 (GRCm39) intron probably benign
R0376:Cacna1b UTSW 2 24,549,015 (GRCm39) splice site probably benign
R0383:Cacna1b UTSW 2 24,651,856 (GRCm39) missense probably damaging 1.00
R0432:Cacna1b UTSW 2 24,577,716 (GRCm39) missense probably damaging 1.00
R0595:Cacna1b UTSW 2 24,540,001 (GRCm39) splice site probably benign
R0660:Cacna1b UTSW 2 24,544,458 (GRCm39) missense probably damaging 1.00
R0664:Cacna1b UTSW 2 24,544,458 (GRCm39) missense probably damaging 1.00
R1107:Cacna1b UTSW 2 24,587,615 (GRCm39) missense probably damaging 1.00
R1184:Cacna1b UTSW 2 24,577,757 (GRCm39) splice site probably null
R1445:Cacna1b UTSW 2 24,608,148 (GRCm39) splice site probably benign
R1446:Cacna1b UTSW 2 24,596,189 (GRCm39) missense probably benign 0.01
R1496:Cacna1b UTSW 2 24,568,047 (GRCm39) missense probably benign
R1614:Cacna1b UTSW 2 24,580,819 (GRCm39) missense possibly damaging 0.88
R1626:Cacna1b UTSW 2 24,496,721 (GRCm39) missense probably damaging 1.00
R1917:Cacna1b UTSW 2 24,506,891 (GRCm39) missense probably null 0.80
R1984:Cacna1b UTSW 2 24,538,998 (GRCm39) missense probably damaging 1.00
R1986:Cacna1b UTSW 2 24,538,998 (GRCm39) missense probably damaging 1.00
R1989:Cacna1b UTSW 2 24,611,386 (GRCm39) missense probably damaging 1.00
R1990:Cacna1b UTSW 2 24,622,318 (GRCm39) missense probably damaging 1.00
R1991:Cacna1b UTSW 2 24,622,318 (GRCm39) missense probably damaging 1.00
R1992:Cacna1b UTSW 2 24,622,318 (GRCm39) missense probably damaging 1.00
R2098:Cacna1b UTSW 2 24,540,558 (GRCm39) missense probably damaging 1.00
R2139:Cacna1b UTSW 2 24,569,485 (GRCm39) missense probably benign 0.07
R2196:Cacna1b UTSW 2 24,651,800 (GRCm39) missense probably damaging 1.00
R2229:Cacna1b UTSW 2 24,575,816 (GRCm39) missense probably damaging 1.00
R2292:Cacna1b UTSW 2 24,496,632 (GRCm39) missense probably benign 0.01
R2570:Cacna1b UTSW 2 24,496,649 (GRCm39) nonsense probably null
R2850:Cacna1b UTSW 2 24,651,800 (GRCm39) missense probably damaging 1.00
R2911:Cacna1b UTSW 2 24,497,553 (GRCm39) splice site probably null
R2937:Cacna1b UTSW 2 24,496,540 (GRCm39) missense probably benign 0.00
R2938:Cacna1b UTSW 2 24,496,540 (GRCm39) missense probably benign 0.00
R3522:Cacna1b UTSW 2 24,653,055 (GRCm39) missense possibly damaging 0.94
R3800:Cacna1b UTSW 2 24,548,971 (GRCm39) missense probably benign 0.15
R4166:Cacna1b UTSW 2 24,567,923 (GRCm39) missense probably benign 0.32
R4366:Cacna1b UTSW 2 24,592,632 (GRCm39) missense probably damaging 1.00
R4493:Cacna1b UTSW 2 24,542,950 (GRCm39) missense probably damaging 0.99
R4494:Cacna1b UTSW 2 24,542,950 (GRCm39) missense probably damaging 0.99
R4522:Cacna1b UTSW 2 24,544,442 (GRCm39) missense probably damaging 1.00
R4612:Cacna1b UTSW 2 24,516,864 (GRCm39) nonsense probably null
R4673:Cacna1b UTSW 2 24,521,956 (GRCm39) missense probably damaging 1.00
R4703:Cacna1b UTSW 2 24,544,475 (GRCm39) missense probably damaging 1.00
R4704:Cacna1b UTSW 2 24,544,475 (GRCm39) missense probably damaging 1.00
R4777:Cacna1b UTSW 2 24,622,337 (GRCm39) missense probably damaging 1.00
R4795:Cacna1b UTSW 2 24,527,499 (GRCm39) missense possibly damaging 0.58
R4796:Cacna1b UTSW 2 24,527,499 (GRCm39) missense possibly damaging 0.58
R4962:Cacna1b UTSW 2 24,547,378 (GRCm39) missense probably damaging 1.00
R4962:Cacna1b UTSW 2 24,508,330 (GRCm39) missense probably damaging 1.00
R4974:Cacna1b UTSW 2 24,538,535 (GRCm39) missense probably damaging 0.99
R4990:Cacna1b UTSW 2 24,568,886 (GRCm39) critical splice donor site probably null
R5109:Cacna1b UTSW 2 24,580,797 (GRCm39) missense possibly damaging 0.88
R5117:Cacna1b UTSW 2 24,622,340 (GRCm39) missense probably damaging 1.00
R5176:Cacna1b UTSW 2 24,525,143 (GRCm39) missense probably damaging 1.00
R5253:Cacna1b UTSW 2 24,609,964 (GRCm39) missense probably damaging 1.00
R5372:Cacna1b UTSW 2 24,623,971 (GRCm39) missense probably damaging 1.00
R5374:Cacna1b UTSW 2 24,596,228 (GRCm39) missense probably damaging 1.00
R5465:Cacna1b UTSW 2 24,540,438 (GRCm39) critical splice donor site probably null
R5568:Cacna1b UTSW 2 24,497,612 (GRCm39) missense probably damaging 1.00
R5580:Cacna1b UTSW 2 24,540,566 (GRCm39) missense probably damaging 1.00
R5677:Cacna1b UTSW 2 24,569,370 (GRCm39) missense possibly damaging 0.64
R6277:Cacna1b UTSW 2 24,620,808 (GRCm39) missense probably damaging 1.00
R6294:Cacna1b UTSW 2 24,609,069 (GRCm39) missense possibly damaging 0.94
R6609:Cacna1b UTSW 2 24,543,061 (GRCm39) missense probably damaging 1.00
R6929:Cacna1b UTSW 2 24,522,022 (GRCm39) missense probably damaging 1.00
R7016:Cacna1b UTSW 2 24,652,860 (GRCm39) missense possibly damaging 0.77
R7112:Cacna1b UTSW 2 24,580,773 (GRCm39) missense probably damaging 0.97
R7162:Cacna1b UTSW 2 24,590,034 (GRCm39) missense probably benign 0.06
R7401:Cacna1b UTSW 2 24,569,306 (GRCm39) missense probably benign 0.00
R7402:Cacna1b UTSW 2 24,497,671 (GRCm39) missense probably benign 0.21
R7442:Cacna1b UTSW 2 24,497,513 (GRCm39) missense probably benign
R7450:Cacna1b UTSW 2 24,525,147 (GRCm39) nonsense probably null
R7481:Cacna1b UTSW 2 24,506,874 (GRCm39) missense probably damaging 0.99
R7792:Cacna1b UTSW 2 24,567,977 (GRCm39) missense probably damaging 0.99
R7999:Cacna1b UTSW 2 24,540,638 (GRCm39) missense probably damaging 1.00
R8041:Cacna1b UTSW 2 24,547,311 (GRCm39) missense probably damaging 1.00
R8084:Cacna1b UTSW 2 24,575,808 (GRCm39) missense probably benign 0.21
R8147:Cacna1b UTSW 2 24,569,188 (GRCm39) missense probably damaging 0.97
R8170:Cacna1b UTSW 2 24,568,886 (GRCm39) critical splice donor site probably null
R8371:Cacna1b UTSW 2 24,610,036 (GRCm39) missense possibly damaging 0.46
R8391:Cacna1b UTSW 2 24,596,212 (GRCm39) missense probably damaging 1.00
R8723:Cacna1b UTSW 2 24,548,510 (GRCm39) missense probably damaging 1.00
R8836:Cacna1b UTSW 2 24,542,982 (GRCm39) missense possibly damaging 0.93
R8856:Cacna1b UTSW 2 24,569,530 (GRCm39) missense probably benign 0.00
R8922:Cacna1b UTSW 2 24,622,340 (GRCm39) missense possibly damaging 0.94
R8940:Cacna1b UTSW 2 24,653,084 (GRCm39) unclassified probably benign
R9140:Cacna1b UTSW 2 24,525,224 (GRCm39) missense probably damaging 1.00
R9414:Cacna1b UTSW 2 24,538,514 (GRCm39) missense probably damaging 0.99
R9476:Cacna1b UTSW 2 24,540,058 (GRCm39) missense probably damaging 0.99
R9510:Cacna1b UTSW 2 24,540,058 (GRCm39) missense probably damaging 0.99
R9520:Cacna1b UTSW 2 24,651,799 (GRCm39) missense probably damaging 0.97
R9566:Cacna1b UTSW 2 24,498,092 (GRCm39) nonsense probably null
R9671:Cacna1b UTSW 2 24,596,282 (GRCm39) missense probably benign 0.00
R9757:Cacna1b UTSW 2 24,609,113 (GRCm39) missense probably damaging 0.99
R9784:Cacna1b UTSW 2 24,651,801 (GRCm39) missense possibly damaging 0.88
R9797:Cacna1b UTSW 2 24,508,287 (GRCm39) missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24,623,957 (GRCm39) missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24,551,856 (GRCm39) missense probably damaging 1.00
Z1176:Cacna1b UTSW 2 24,516,896 (GRCm39) nonsense probably null
Z1177:Cacna1b UTSW 2 24,569,000 (GRCm39) missense probably damaging 0.97
Z1177:Cacna1b UTSW 2 24,551,802 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1b UTSW 2 24,528,689 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTGGACTGGGTCAAAATCAG -3'
(R):5'- AGTGCAGTAGATCATGCCCG -3'

Sequencing Primer
(F):5'- GCCAACAGAAGATGACCTGTG -3'
(R):5'- AGTAGATCATGCCCGGGACTTTC -3'
Posted On 2016-04-07