Incidental Mutation 'R4940:Traf2'
ID382976
Institutional Source Beutler Lab
Gene Symbol Traf2
Ensembl Gene ENSMUSG00000026942
Gene NameTNF receptor-associated factor 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4940 (G1)
Quality Score212
Status Not validated
Chromosome2
Chromosomal Location25517982-25546940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25530288 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 183 (E183G)
Ref Sequence ENSEMBL: ENSMUSP00000109872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028311] [ENSMUST00000114234]
Predicted Effect probably null
Transcript: ENSMUST00000028311
AA Change: E176G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028311
Gene: ENSMUSG00000026942
AA Change: E176G

DomainStartEndE-ValueType
RING 34 72 3.19e-3 SMART
Pfam:zf-TRAF 178 235 1.9e-22 PFAM
MATH 356 478 3.09e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114234
AA Change: E183G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109872
Gene: ENSMUSG00000026942
AA Change: E183G

DomainStartEndE-ValueType
RING 34 79 3.42e-2 SMART
Pfam:zf-TRAF 185 242 2.4e-23 PFAM
Pfam:TRAF_BIRC3_bd 274 337 1.6e-34 PFAM
MATH 363 485 3.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151742
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Increased lethaltiy is observed with homozygous null mice. Offspring are runted and exhibit atrophic thymii and spleens with reduced numbers of lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Abca15 T C 7: 120,332,694 Y57H probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Extl2 G C 3: 116,027,192 K229N probably benign Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Mtus1 T A 8: 41,041,478 H39L possibly damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Rrp8 A T 7: 105,734,077 Y327* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Traf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Traf2 APN 2 25520451 nonsense probably null
IGL01010:Traf2 APN 2 25520438 nonsense probably null
IGL01063:Traf2 APN 2 25524919 missense probably benign 0.00
IGL01146:Traf2 APN 2 25524919 missense probably benign 0.00
IGL02114:Traf2 APN 2 25524992 missense possibly damaging 0.50
IGL02319:Traf2 APN 2 25536683 missense probably damaging 0.99
R0116:Traf2 UTSW 2 25519609 missense probably damaging 1.00
R0238:Traf2 UTSW 2 25537126 missense possibly damaging 0.90
R0238:Traf2 UTSW 2 25537126 missense possibly damaging 0.90
R1741:Traf2 UTSW 2 25524483 missense probably damaging 1.00
R3605:Traf2 UTSW 2 25530415 missense probably benign 0.02
R3607:Traf2 UTSW 2 25530415 missense probably benign 0.02
R5296:Traf2 UTSW 2 25520440 missense probably damaging 1.00
R5784:Traf2 UTSW 2 25539037 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GTCAGTACTAATTACCCAGTTCCACC -3'
(R):5'- CAAGCCACTTGCATGTGCTG -3'

Sequencing Primer
(F):5'- CAAAAACCTTCTAAACTCCATGACG -3'
(R):5'- CACTTGCATGTGCTGTGGCC -3'
Posted On2016-04-27