Incidental Mutation 'R4943:2210408I21Rik'
List |< first << previous [record 72 of 18487] next >> last >|
ID383295
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77245327 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 366 (T366K)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779] [ENSMUST00000225760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: T366K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: T366K

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225760
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTTGCCTAAATTACAAAGCAT -3'
(R):5'- CCAGGGGAGGCATGATTTTA -3'

Sequencing Primer
(F):5'- TGCTCACAGAAGGAAAGAC -3'
(R):5'- AGGCATGATTTTAGTCCAGGAC -3'
Posted On2016-04-27