Mutagenetix > Incidental Mutation

Incidental Mutation 'R5109:Dhfr'

393763

Institutional Source

Beutler Lab

Gene Symbol

Dhfr

Ensembl Gene

ENSMUSG00000021707

Gene Name

dihydrofolate reductase

Synonyms

8430436I03Rik

MMRRC Submission

042697-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5109 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

92491291-92525561 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92491788 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 8 (I8F)

Ref Sequence

ENSEMBL: ENSMUSP00000022218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022218] [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000191509] [ENSMUST00000191550] [ENSMUST00000190393]

AlphaFold

P00375

PDB Structure

Understanding the Role of Leu22 Variants in Methotrexate Resistance: Comparison of Wild-type and Leu22Arg Variant Mouse and Human Dihydrofolate Reductase [X-RAY DIFFRACTION]
New Insights into DHFR Interactions: Analysis of Pneumocystis carinii and Mouse DHFR Complexes with NADPH and Two Highly Potent Trimethoprim Derivatives [X-RAY DIFFRACTION]
Structural Analysis of a Holo Enzyme Complex of Mouse Dihydrofolate Reductase with NADPH and a Ternary Complex wtih the Potent and Selective Inhibitor 2,4-Diamino-6-(2'-hydroxydibenz[b,f]azepin-5-yl)methylpteridine [X-RAY DIFFRACTION]
Structural Analysis of a Holo Enzyme Complex of Mouse Dihydrofolate Reductase with NADPH and a Ternary Complex with the Potent and Selective Inhibitor 2.4-Diamino-6-(-2'-hydroxydibenz[b,f]azepin-5-yl)methylpteridine [X-RAY DIFFRACTION]
Alternate Binding Modes Observed for the E- and Z-isomers of 2,4-Diaminofuro[2,3d]pyrimidines as Ternary Complexes with NADPH and Mouse Dihydrofolate Reductase [X-RAY DIFFRACTION]
Alternate Binding Modes Observed for the E- and Z-Isomers of 2,4-Diaminofuro[2,3-d]pyrimidines as Ternary Complexes with NADPH and Mouse Dihydrofolate Reductase [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022218
AA Change: I8F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707
AA Change: I8F

Domain	Start	End	E-Value	Type
Pfam:DHFR_1	4	185	3.9e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000022220

SMART Domains

Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	1.6e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185852

SMART Domains

Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	7.2e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186878

Predicted Effect

probably benign
Transcript: ENSMUST00000187424

SMART Domains

Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187831

Predicted Effect

probably benign
Transcript: ENSMUST00000187874

SMART Domains

Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191509

SMART Domains

Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191550

SMART Domains

Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190393

SMART Domains

Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	241	6.4e-10	PFAM
low complexity region	261	285	N/A	INTRINSIC

Meta Mutation Damage Score

0.6983

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.2%

Validation Efficiency

95% (78/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality soon after E14.5 with reduced size, pallor, impaired hematopoiesis and abnormal folic acid levels. Mice heterozygous for this allele exhibit abnormal folic acid levels, abnormal hemopoiesis and reduced endothelium-dependent vasorelaxation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	T	C	5: 90,391,395 (GRCm39)	S1841G	possibly damaging	Het
Anxa10	T	C	8: 62,516,093 (GRCm39)	E193G	possibly damaging	Het
Ap3d1	T	C	10: 80,545,284 (GRCm39)	S1056G	probably benign	Het
Apbb1	T	C	7: 105,214,242 (GRCm39)	N62D	probably damaging	Het
Apobec2	A	T	17: 48,730,022 (GRCm39)	Y215N	probably damaging	Het
Apobec2	T	A	17: 48,730,024 (GRCm39)	Y214F	probably damaging	Het
Appl2	A	T	10: 83,436,871 (GRCm39)	V630E	probably benign	Het
Bud23	T	C	5: 135,089,877 (GRCm39)		probably benign	Het
Cacna1b	A	T	2: 24,580,797 (GRCm39)	M683K	possibly damaging	Het
Cbfa2t2	T	A	2: 154,373,293 (GRCm39)	D187E	probably damaging	Het
Cfap54	G	T	10: 92,773,753 (GRCm39)	F96L	probably benign	Het
Cimap1a	A	T	7: 140,429,461 (GRCm39)	S197C	probably benign	Het
Crebbp	A	G	16: 3,906,295 (GRCm39)		probably benign	Het
Crocc	C	T	4: 140,755,722 (GRCm39)	R1102Q	probably damaging	Het
Dcaf12	T	C	4: 41,298,329 (GRCm39)	D273G	possibly damaging	Het
Dchs1	T	C	7: 105,414,221 (GRCm39)	T865A	probably benign	Het
Dnaja2	A	T	8: 86,279,887 (GRCm39)	F97L	possibly damaging	Het
Dnase1l1	C	T	X: 73,320,644 (GRCm39)		probably null	Het
Doc2b	T	C	11: 75,667,967 (GRCm39)	D261G	probably benign	Het
Ear1	A	G	14: 44,056,485 (GRCm39)	Y128H	probably benign	Het
Elac2	T	A	11: 64,883,142 (GRCm39)	I171N	probably damaging	Het
Entpd3	C	A	9: 120,395,380 (GRCm39)	N454K	possibly damaging	Het
Flrt3	A	G	2: 140,502,663 (GRCm39)	S322P	possibly damaging	Het
Fn1	C	T	1: 71,688,394 (GRCm39)	C170Y	probably damaging	Het
Gabbr1	T	A	17: 37,382,920 (GRCm39)		probably benign	Het
Gm7247	T	G	14: 51,602,774 (GRCm39)	S37A	probably damaging	Het
Gm8775	T	A	3: 4,277,008 (GRCm39)		noncoding transcript	Het
Gprc5c	G	T	11: 114,755,093 (GRCm39)	V257L	possibly damaging	Het
Gria4	A	C	9: 4,472,168 (GRCm39)	N440K	probably damaging	Het
H2-T22	T	A	17: 36,350,113 (GRCm39)	R334*	probably null	Het
Ift172	T	C	5: 31,423,330 (GRCm39)	D817G	probably benign	Het
Igkv9-124	T	A	6: 67,919,348 (GRCm39)	R21S	possibly damaging	Het
Itgam	G	A	7: 127,712,390 (GRCm39)	V846I	probably benign	Het
Kif11	T	A	19: 37,373,063 (GRCm39)	M94K	possibly damaging	Het
Krtcap2	T	C	3: 89,154,085 (GRCm39)	V2A	probably benign	Het
Lrrc47	A	G	4: 154,101,933 (GRCm39)	D400G	probably damaging	Het
Man2a1	T	A	17: 65,059,443 (GRCm39)	V1110E	probably benign	Het
Mfsd9	T	A	1: 40,813,365 (GRCm39)	I317F	probably damaging	Het
Mindy4	A	T	6: 55,193,730 (GRCm39)		probably null	Het
Mrpl53	A	G	6: 83,086,541 (GRCm39)	T82A	probably damaging	Het
Myo3b	A	G	2: 69,925,637 (GRCm39)	K35E	possibly damaging	Het
Nalcn	A	G	14: 123,515,650 (GRCm39)	V1717A	possibly damaging	Het
Ncoa2	A	G	1: 13,257,070 (GRCm39)	V143A	probably damaging	Het
Ndufa9	A	C	6: 126,809,520 (GRCm39)		probably null	Het
Or10ag60	G	A	2: 87,438,319 (GRCm39)	G196R	possibly damaging	Het
Or10ag60	G	A	2: 87,437,755 (GRCm39)	A8T	possibly damaging	Het
Or12e9	A	G	2: 87,201,878 (GRCm39)	M1V	probably null	Het
Or5k17	A	G	16: 58,746,422 (GRCm39)	S171P	probably benign	Het
Or5p55	T	C	7: 107,567,104 (GRCm39)	S167P	probably benign	Het
Or6c202	T	C	10: 128,996,106 (GRCm39)	Y249C	probably damaging	Het
Or7g28	A	T	9: 19,272,438 (GRCm39)	I71N	probably damaging	Het
Or9g8	G	A	2: 85,607,668 (GRCm39)	V247M	probably damaging	Het
Pde4b	G	T	4: 102,458,741 (GRCm39)	A466S	probably damaging	Het
Pfkfb3	A	T	2: 11,491,162 (GRCm39)		probably benign	Het
Ppp1r21	A	G	17: 88,866,268 (GRCm39)	K355E	probably damaging	Het
Psme4	T	A	11: 30,741,095 (GRCm39)	Y90*	probably null	Het
Rbms1	G	A	2: 60,612,284 (GRCm39)	L161F	probably damaging	Het
Rdh16f2	A	G	10: 127,702,672 (GRCm39)	D83G	probably damaging	Het
Sec16b	C	T	1: 157,392,361 (GRCm39)	R910*	probably null	Het
Sema4c	CTGGGCTT	C	1: 36,591,381 (GRCm39)		probably null	Het
Spata31e5	T	C	1: 28,816,636 (GRCm39)	I465M	possibly damaging	Het
Stambp	A	G	6: 83,540,803 (GRCm39)		probably null	Het
Tcf21	T	C	10: 22,695,558 (GRCm39)	N82S	probably damaging	Het
Tlr2	A	T	3: 83,745,030 (GRCm39)	V351D	probably damaging	Het
Tmem39a	G	A	16: 38,411,326 (GRCm39)	G359D	probably damaging	Het
Ttc23l	G	T	15: 10,551,636 (GRCm39)	T30K	possibly damaging	Het
Vmn2r17	C	A	5: 109,577,342 (GRCm39)	F464L	probably benign	Het
Vmn2r49	T	A	7: 9,710,204 (GRCm39)	T843S	probably benign	Het
Vmn2r7	T	C	3: 64,598,088 (GRCm39)	D823G	probably null	Het
Wrnip1	T	A	13: 33,000,319 (GRCm39)	L442Q	probably damaging	Het
Zbtb38	G	T	9: 96,569,062 (GRCm39)	S674Y	probably damaging	Het
Zfp639	T	G	3: 32,574,585 (GRCm39)		probably null	Het

Other mutations in Dhfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01659:Dhfr	APN	13	92,492,178 (GRCm39)	splice site	probably null
R0546:Dhfr	UTSW	13	92,504,692 (GRCm39)	critical splice acceptor site	probably null
R1465:Dhfr	UTSW	13	92,504,815 (GRCm39)	splice site	probably benign
R2026:Dhfr	UTSW	13	92,502,279 (GRCm39)	nonsense	probably null
R4905:Dhfr	UTSW	13	92,502,282 (GRCm39)	missense	probably damaging	1.00
R7039:Dhfr	UTSW	13	92,491,791 (GRCm39)	missense	probably benign	0.04
R7869:Dhfr	UTSW	13	92,494,471 (GRCm39)	nonsense	probably null
R8905:Dhfr	UTSW	13	92,494,467 (GRCm39)	missense	probably damaging	1.00
R9509:Dhfr	UTSW	13	92,504,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCACAAATAGGATGCGC -3'
(R):5'- AACCGGTAGCTTGGTCTCTG -3'

Sequencing Primer
(F):5'- CAAATAGGATGCGCGGCGG -3'
(R):5'- CTTGGTCTCTGGCTGAGGC -3'

Posted On

2016-06-15