Incidental Mutation 'R0452:Lgals3bp'
ID39710
Institutional Source Beutler Lab
Gene Symbol Lgals3bp
Ensembl Gene ENSMUSG00000033880
Gene Namelectin, galactoside-binding, soluble, 3 binding protein
SynonymsPpicap, MAC-2BP, 90K, CyCAP, Tango10b
MMRRC Submission 038652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0452 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118392751-118402092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118393464 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 430 (Y430N)
Ref Sequence ENSEMBL: ENSMUSP00000035579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043722] [ENSMUST00000106290]
Predicted Effect probably benign
Transcript: ENSMUST00000043722
AA Change: Y430N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035579
Gene: ENSMUSG00000033880
AA Change: Y430N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
SR 24 124 1.43e-52 SMART
BTB 153 251 8.57e-6 SMART
BACK 260 360 1.78e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106290
SMART Domains Protein: ENSMUSP00000101897
Gene: ENSMUSG00000033880

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
SR 24 124 1.43e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141459
Predicted Effect probably benign
Transcript: ENSMUST00000144529
Meta Mutation Damage Score 0.1584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are more susceptible to bacterial infection and overproduce IL-12, interferon-gamma and TNF-alpha. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Lgals3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Lgals3bp APN 11 118393464 missense probably benign
IGL02439:Lgals3bp APN 11 118398220 missense probably damaging 1.00
R0319:Lgals3bp UTSW 11 118393521 missense probably damaging 1.00
R0499:Lgals3bp UTSW 11 118398193 unclassified probably null
R0605:Lgals3bp UTSW 11 118393394 missense probably damaging 1.00
R0962:Lgals3bp UTSW 11 118393020 makesense probably null
R1701:Lgals3bp UTSW 11 118393955 missense probably damaging 1.00
R2132:Lgals3bp UTSW 11 118393287 missense probably benign 0.00
R4696:Lgals3bp UTSW 11 118398151 missense probably benign 0.02
R4720:Lgals3bp UTSW 11 118398469 missense probably damaging 1.00
R4783:Lgals3bp UTSW 11 118393514 missense probably damaging 1.00
R4785:Lgals3bp UTSW 11 118393514 missense probably damaging 1.00
R4926:Lgals3bp UTSW 11 118393955 missense probably damaging 1.00
R5504:Lgals3bp UTSW 11 118393985 missense probably benign 0.37
R6077:Lgals3bp UTSW 11 118399742 missense probably damaging 1.00
R6280:Lgals3bp UTSW 11 118393280 missense possibly damaging 0.92
R7069:Lgals3bp UTSW 11 118393173 missense probably benign 0.00
R7114:Lgals3bp UTSW 11 118393483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACGAGAAGCCATAGTTCCAGCAG -3'
(R):5'- TCACACGAGGATATAGAGCGCCTG -3'

Sequencing Primer
(F):5'- TTCCAGCAGCTCTGCATGG -3'
(R):5'- TGTCCTTGTACCAAGATCACCAG -3'
Posted On2013-05-23