Mutagenetix > Incidental Mutation

Incidental Mutation 'R5246:Srpk3'

401170

Institutional Source

Beutler Lab

Gene Symbol

Srpk3

Ensembl Gene

ENSMUSG00000002007

Gene Name

serine/arginine-rich protein specific kinase 3

Synonyms

Mssk1, Stk23

MMRRC Submission

042817-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5246 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

72818011-72822531 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 72818555 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 82 (R82*)

Ref Sequence

ENSEMBL: ENSMUSP00000002081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002079] [ENSMUST00000002081] [ENSMUST00000052761]

AlphaFold

Q9Z0G2

Predicted Effect

probably benign
Transcript: ENSMUST00000002079

SMART Domains

Protein: ENSMUSP00000002079
Gene: ENSMUSG00000031385

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
Sema	44	445	5.53e-102	SMART
PSI	463	515	8.91e-10	SMART
Blast:Sema	533	592	2e-9	BLAST
PSI	609	671	8.95e-1	SMART
PSI	776	822	5e-1	SMART
IPT	823	914	7.15e-15	SMART
IPT	915	1001	5.63e-13	SMART
IPT	1003	1134	7.17e-1	SMART
Pfam:TIG	1148	1232	7.7e-7	PFAM
low complexity region	1246	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1317	1869	2.7e-225	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000002081
AA Change: R82*

SMART Domains

Protein: ENSMUSP00000002081
Gene: ENSMUSG00000002007
AA Change: R82*

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
Pfam:Pkinase	78	228	1.4e-22	PFAM
Pfam:Pkinase_Tyr	78	230	1.1e-9	PFAM
coiled coil region	260	300	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	341	360	N/A	INTRINSIC
Pfam:Pkinase	385	563	2.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000052761

SMART Domains

Protein: ENSMUSP00000056502
Gene: ENSMUSG00000002010

Domain	Start	End	E-Value	Type
low complexity region	1	17	N/A	INTRINSIC
Iso_dh	56	379	1.1e-141	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129070

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137045

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149478

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147127

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase similar to a protein kinase which is specific for the SR (serine/arginine-rich domain) family of splicing factors. A highly similar protein has been shown to play a role in muscle development in mice. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mice exhibit defects in skeletal muscle growth and myopathy of type 2 muscle fibers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg6	T	A	10: 14,302,509 (GRCm39)	Y968F	probably damaging	Het
Bltp1	G	A	3: 37,102,199 (GRCm39)	R1299Q	probably damaging	Het
Brwd1	G	A	16: 95,803,757 (GRCm39)	P2138S	probably damaging	Het
Cdkl4	T	A	17: 80,846,913 (GRCm39)		probably null	Het
Cep55	T	A	19: 38,058,119 (GRCm39)	D237E	probably benign	Het
Clhc1	T	A	11: 29,525,434 (GRCm39)	S503T	probably damaging	Het
Cybb	C	G	X: 9,316,989 (GRCm39)	D246H	probably benign	Het
Efcab5	T	C	11: 77,079,671 (GRCm39)	Y25C	probably damaging	Het
Eif3c	G	A	7: 126,156,410 (GRCm39)	T444I	possibly damaging	Het
Epb41l4b	G	T	4: 57,040,989 (GRCm39)	N491K	probably damaging	Het
Gm9776	A	T	13: 94,495,065 (GRCm39)		probably benign	Het
Lrcol1	A	C	5: 110,502,377 (GRCm39)	E84D	possibly damaging	Het
Lrp1b	A	G	2: 41,360,952 (GRCm39)		probably null	Het
Mup5	T	A	4: 61,752,874 (GRCm39)	I50L	probably benign	Het
Myo16	A	T	8: 10,612,212 (GRCm39)	K1286*	probably null	Het
Pramel22	G	T	4: 143,382,127 (GRCm39)	P190T	probably benign	Het
Prss46	T	A	9: 110,679,102 (GRCm39)	V101D	probably damaging	Het
Rint1	T	A	5: 24,005,809 (GRCm39)	W164R	probably damaging	Het
Rnf139	G	A	15: 58,771,552 (GRCm39)	V526I	probably damaging	Het
Rptn	A	T	3: 93,304,140 (GRCm39)	D491V	probably damaging	Het
Rptn	A	G	3: 93,305,036 (GRCm39)	T790A	possibly damaging	Het
Scn8a	T	C	15: 100,908,938 (GRCm39)	L802P	probably damaging	Het
Scrib	T	C	15: 75,936,646 (GRCm39)	E435G	probably benign	Het
Sdk1	C	A	5: 142,100,317 (GRCm39)	T1449K	possibly damaging	Het
Septin7	T	A	9: 25,210,832 (GRCm39)	L289M	probably damaging	Het
Spry1	A	G	3: 37,696,916 (GRCm39)	Y53C	probably damaging	Het
Tmcc1	A	G	6: 116,020,381 (GRCm39)	V142A	probably damaging	Het
Vmn2r45	T	G	7: 8,486,251 (GRCm39)	T346P	probably benign	Het
Wdr25	A	G	12: 108,993,382 (GRCm39)	I533V	probably benign	Het
Zfp292	A	C	4: 34,805,842 (GRCm39)	Y2401D	possibly damaging	Het

Other mutations in Srpk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02211:Srpk3	APN	X	72,818,754 (GRCm39)	missense	probably benign	0.33
Myo_bone	UTSW	X	72,818,555 (GRCm39)	nonsense	probably null
R1822:Srpk3	UTSW	X	72,821,561 (GRCm39)	missense	possibly damaging	0.79
R1823:Srpk3	UTSW	X	72,821,561 (GRCm39)	missense	possibly damaging	0.79
R4601:Srpk3	UTSW	X	72,818,547 (GRCm39)	missense	possibly damaging	0.47
R4611:Srpk3	UTSW	X	72,818,547 (GRCm39)	missense	possibly damaging	0.47
R5247:Srpk3	UTSW	X	72,818,555 (GRCm39)	nonsense	probably null
R5248:Srpk3	UTSW	X	72,818,555 (GRCm39)	nonsense	probably null
R5249:Srpk3	UTSW	X	72,818,555 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TATTGCAAGGGTAAGGCCTG -3'
(R):5'- ACTTTCAGGGCCACAAAGCG -3'

Sequencing Primer
(F):5'- CAAGGGCTCAGGACAGCTTG -3'
(R):5'- AAAGCGCTTGCGCCTGTAATATG -3'

Posted On

2016-07-06