Incidental Mutation 'R5293:Ssrp1'
ID405233
Institutional Source Beutler Lab
Gene Symbol Ssrp1
Ensembl Gene ENSMUSG00000027067
Gene Namestructure specific recognition protein 1
SynonymsHmgi-rs3, T160, Hmgox, Hmg1-rs1
MMRRC Submission 042876-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5293 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85037234-85047109 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85042252 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 411 (Y411*)
Ref Sequence ENSEMBL: ENSMUSP00000127058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077798] [ENSMUST00000111613] [ENSMUST00000130729] [ENSMUST00000168266]
Predicted Effect probably null
Transcript: ENSMUST00000077798
AA Change: Y411*
SMART Domains Protein: ENSMUSP00000076971
Gene: ENSMUSG00000027067
AA Change: Y411*

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 1.7e-105 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111613
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127069
Predicted Effect probably null
Transcript: ENSMUST00000130729
AA Change: Y411*
SMART Domains Protein: ENSMUSP00000121639
Gene: ENSMUSG00000027067
AA Change: Y411*

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 5.7e-106 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146530
Predicted Effect probably null
Transcript: ENSMUST00000168266
AA Change: Y411*
SMART Domains Protein: ENSMUSP00000127058
Gene: ENSMUSG00000027067
AA Change: Y411*

DomainStartEndE-ValueType
Pfam:SSrecog 75 284 8.8e-91 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene is lethal resulting in death at some point between implantation and E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,810,706 V269A possibly damaging Het
Akap9 C T 5: 3,948,687 R19W probably damaging Het
Akr7a5 G T 4: 139,314,206 R142L probably benign Het
Atp6v0a2 A T 5: 124,646,709 M311L probably benign Het
Atxn1 C T 13: 45,568,368 R17H probably damaging Het
Ccdc116 A T 16: 17,141,787 L346Q possibly damaging Het
Copg2 T A 6: 30,826,227 N261I probably damaging Het
Crtc2 A G 3: 90,263,564 E648G probably benign Het
Dnah10 A C 5: 124,791,787 K2334Q probably benign Het
Foxa2 T C 2: 148,044,002 T123A probably benign Het
Galnt6 A G 15: 100,703,501 V299A probably benign Het
Grip1 T C 10: 119,897,735 S26P probably damaging Het
Jkamp A G 12: 72,090,109 S84G probably benign Het
Kcnc1 A G 7: 46,397,811 H45R probably benign Het
Knl1 T C 2: 119,069,695 Y626H probably damaging Het
Mmp19 T A 10: 128,791,101 V16D probably damaging Het
Mrpl38 T C 11: 116,132,773 N280S probably benign Het
Myl7 T A 11: 5,898,521 probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,503,429 probably benign Het
Nlrp2 A C 7: 5,327,615 L594R probably damaging Het
Olfr1309 T G 2: 111,983,266 K269N probably damaging Het
Olfr131 T A 17: 38,082,240 H246L probably damaging Het
Olfr668 T C 7: 104,925,279 T162A probably benign Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,535,750 V2070A probably benign Het
Plcxd2 G T 16: 45,980,343 H173N probably damaging Het
Plec C G 15: 76,199,583 W26C probably benign Het
Psmc1 C T 12: 100,115,472 T111I probably benign Het
Rbfa T C 18: 80,192,766 E256G probably benign Het
Sh3d21 T A 4: 126,152,257 T173S probably benign Het
Slc41a3 T A 6: 90,626,444 V149E probably damaging Het
Sntg1 A G 1: 8,595,533 S186P probably damaging Het
Spag4 A G 2: 156,066,191 D29G probably benign Het
Spc25 A G 2: 69,202,652 V43A possibly damaging Het
Spen G A 4: 141,472,406 A2947V possibly damaging Het
Spta1 T C 1: 174,195,985 S653P probably damaging Het
Synrg C T 11: 83,981,499 L149F probably damaging Het
Trappc11 G A 8: 47,493,342 A1085V possibly damaging Het
Ttn T C 2: 76,740,932 E18212G probably damaging Het
Wnk4 T G 11: 101,275,197 probably benign Het
Other mutations in Ssrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ssrp1 APN 2 85041099 splice site probably benign
IGL01935:Ssrp1 APN 2 85046712 makesense probably null
IGL02226:Ssrp1 APN 2 85040361 missense probably damaging 1.00
IGL02793:Ssrp1 APN 2 85040920 missense probably damaging 1.00
IGL02875:Ssrp1 APN 2 85040920 missense probably damaging 1.00
Dickcissel UTSW 2 85041634 missense probably damaging 0.96
Meadowlark UTSW 2 85041106 critical splice acceptor site probably null
PIT4131001:Ssrp1 UTSW 2 85038416 missense probably damaging 1.00
R0313:Ssrp1 UTSW 2 85041554 missense probably damaging 1.00
R0363:Ssrp1 UTSW 2 85040674 missense probably damaging 0.99
R1234:Ssrp1 UTSW 2 85042263 missense probably damaging 1.00
R1643:Ssrp1 UTSW 2 85041185 missense possibly damaging 0.89
R1713:Ssrp1 UTSW 2 85040760 missense probably damaging 0.99
R2049:Ssrp1 UTSW 2 85041427 splice site probably benign
R2113:Ssrp1 UTSW 2 85043006 splice site probably null
R2291:Ssrp1 UTSW 2 85042316 critical splice donor site probably null
R2471:Ssrp1 UTSW 2 85042298 missense possibly damaging 0.95
R2965:Ssrp1 UTSW 2 85041586 missense possibly damaging 0.46
R3552:Ssrp1 UTSW 2 85044392 missense probably benign
R4060:Ssrp1 UTSW 2 85041634 missense probably damaging 0.96
R4075:Ssrp1 UTSW 2 85045568 missense possibly damaging 0.68
R4131:Ssrp1 UTSW 2 85044447 missense probably null 0.28
R4326:Ssrp1 UTSW 2 85040217 intron probably benign
R4357:Ssrp1 UTSW 2 85041151 missense probably benign 0.22
R4400:Ssrp1 UTSW 2 85037941 missense probably damaging 0.97
R4797:Ssrp1 UTSW 2 85045722 nonsense probably null
R5571:Ssrp1 UTSW 2 85044325 missense probably damaging 0.99
R5592:Ssrp1 UTSW 2 85045519 missense probably benign 0.00
R5743:Ssrp1 UTSW 2 85041168 nonsense probably null
R5991:Ssrp1 UTSW 2 85042296 missense possibly damaging 0.94
R6019:Ssrp1 UTSW 2 85045452 missense probably damaging 1.00
R6133:Ssrp1 UTSW 2 85045339 intron probably benign
R6157:Ssrp1 UTSW 2 85040728 missense probably damaging 0.99
R6225:Ssrp1 UTSW 2 85042814 missense probably benign 0.02
R6551:Ssrp1 UTSW 2 85041106 critical splice acceptor site probably null
R6886:Ssrp1 UTSW 2 85039936 missense probably benign 0.04
X0023:Ssrp1 UTSW 2 85045475 missense probably benign 0.06
Z1088:Ssrp1 UTSW 2 85040653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGAGCTGTATCTCACCTACTG -3'
(R):5'- ATGCAGAGAGAACCTGCTCAG -3'

Sequencing Primer
(F):5'- ACCTACTGATGTCCTGCGTAGTATAG -3'
(R):5'- GGAAGGAGCCACACGCAC -3'
Posted On2016-07-22