Incidental Mutation 'R5346:Psmc1'
ID422630
Institutional Source Beutler Lab
Gene Symbol Psmc1
Ensembl Gene ENSMUSG00000021178
Gene Nameprotease (prosome, macropain) 26S subunit, ATPase 1
SynonymsS4, Rpt2/S4, rpt2, P26s4
MMRRC Submission 042925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5346 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location100110154-100123405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100120100 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 332 (N332S)
Ref Sequence ENSEMBL: ENSMUSP00000021595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021595]
Predicted Effect probably damaging
Transcript: ENSMUST00000021595
AA Change: N332S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178
AA Change: N332S

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
AAA 218 357 1.57e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223078
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T A 5: 62,714,746 Y513F probably benign Het
Cluh C A 11: 74,665,218 H832N probably damaging Het
Cntfr G T 4: 41,675,042 Y21* probably null Het
Cog2 T C 8: 124,546,631 S570P possibly damaging Het
Cops7b A G 1: 86,583,068 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Dopey1 A G 9: 86,520,782 D1345G probably damaging Het
Dqx1 G A 6: 83,059,719 D235N possibly damaging Het
Dscaml1 A G 9: 45,450,559 I206V possibly damaging Het
Ednra T C 8: 77,674,968 Y231C probably damaging Het
Ehhadh T C 16: 21,762,790 Y484C probably damaging Het
Fmnl3 A T 15: 99,331,990 V150D probably damaging Het
Gabrb2 T A 11: 42,421,389 S14T probably benign Het
Gm10608 GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,724 probably null Het
Gpatch2 T C 1: 187,225,868 L140P probably benign Het
Gsdmc A G 15: 63,776,886 Y400H probably damaging Het
Heatr5b A G 17: 78,827,986 S239P probably benign Het
Hmcn1 A T 1: 150,623,244 I4004N probably damaging Het
Insc T A 7: 114,804,541 N63K possibly damaging Het
Mmp28 T C 11: 83,442,663 H484R probably benign Het
Nptn C A 9: 58,623,787 Y64* probably null Het
Nsd2 T A 5: 33,879,136 S655T possibly damaging Het
Nub1 A G 5: 24,697,416 E253G probably damaging Het
Olfr411 T C 11: 74,346,670 R305G probably benign Het
Pde3b T A 7: 114,506,190 H452Q probably benign Het
Pkhd1 T C 1: 20,392,097 M2078V probably benign Het
Pkhd1 T C 1: 20,523,434 D1485G probably damaging Het
Pkhd1l1 A C 15: 44,540,967 T2331P probably damaging Het
Plk5 G A 10: 80,363,108 G433E probably damaging Het
Pnliprp2 T A 19: 58,759,800 D4E probably benign Het
Prag1 A G 8: 36,103,685 D474G probably damaging Het
Rad9a G C 19: 4,201,518 probably null Het
Slf1 A G 13: 77,092,371 V396A probably benign Het
Stat6 G A 10: 127,652,313 R312K probably benign Het
Tgm1 A T 14: 55,711,172 V174E probably damaging Het
Tnc A G 4: 64,008,655 V878A probably benign Het
Ube4b A T 4: 149,337,424 H969Q possibly damaging Het
Ubr4 T C 4: 139,428,491 I2209T probably damaging Het
Ulk2 A C 11: 61,834,914 L112R probably damaging Het
Wdr35 T C 12: 8,978,684 Y101H probably benign Het
Xpo7 A G 14: 70,683,677 L617P probably damaging Het
Other mutations in Psmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Psmc1 APN 12 100113078 missense probably damaging 1.00
IGL02445:Psmc1 APN 12 100114828 splice site probably benign
IGL02605:Psmc1 APN 12 100119127 missense probably damaging 1.00
R0018:Psmc1 UTSW 12 100116692 splice site probably benign
R0018:Psmc1 UTSW 12 100116692 splice site probably benign
R0427:Psmc1 UTSW 12 100119228 missense probably damaging 0.96
R0534:Psmc1 UTSW 12 100120130 missense possibly damaging 0.79
R0931:Psmc1 UTSW 12 100119082 missense probably damaging 0.99
R1937:Psmc1 UTSW 12 100114843 missense probably benign 0.26
R2405:Psmc1 UTSW 12 100120103 missense probably benign 0.03
R5063:Psmc1 UTSW 12 100115475 missense probably damaging 0.97
R5293:Psmc1 UTSW 12 100115472 missense probably benign 0.11
R5542:Psmc1 UTSW 12 100120140 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGAAAGCATGGAGTTCCCTG -3'
(R):5'- GAGACAGCCTTGAACTCCTC -3'

Sequencing Primer
(F):5'- CATGGAGTTCCCTGCTGTG -3'
(R):5'- AGACAGGTGCTTTCCTAATTAGGCC -3'
Posted On2016-08-04