Incidental Mutation 'R5346:Psmc1'
| ID |
422630 |
| Institutional Source |
Beutler Lab
|
| Gene Symbol |
Psmc1
|
| Ensembl Gene |
ENSMUSG00000021178 |
| Gene Name |
protease (prosome, macropain) 26S subunit, ATPase 1 |
| Synonyms |
P26s4, Rpt2/S4, rpt2, S4 |
| MMRRC Submission |
042925-MU
|
| Accession Numbers |
|
| Essential gene? |
Essential
(E-score: 1.000)
|
| Stock # |
R5346 (G1)
|
| Quality Score |
225 |
|
Status
|
Not validated
|
| Chromosome |
12 |
| Chromosomal Location |
100076461-100089623 bp(+) (GRCm39) |
| Type of Mutation |
missense |
| DNA Base Change (assembly) |
A to G
at 100086359 bp (GRCm39)
|
| Zygosity |
Heterozygous |
| Amino Acid Change |
Asparagine to Serine
at position 332
(N332S)
|
| Ref Sequence |
ENSEMBL: ENSMUSP00000021595
(fasta)
|
| Gene Model |
predicted gene model for transcript(s):
[ENSMUST00000021595]
|
| AlphaFold |
P62192 |
| Predicted Effect |
probably damaging
Transcript: ENSMUST00000021595
AA Change: N332S
PolyPhen 2
Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
|
| SMART Domains |
Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178
AA Change: N332S
| Domain | Start | End | E-Value | Type |
|---|
|
low complexity region
|
7 |
24 |
N/A |
INTRINSIC |
|
low complexity region
|
27 |
43 |
N/A |
INTRINSIC |
|
AAA
|
218 |
357 |
1.57e-23 |
SMART |
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000221308
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000222374
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000223078
|
| Coding Region Coverage |
- 1x: 99.4%
- 3x: 98.8%
- 10x: 97.7%
- 20x: 96.3%
|
| Validation Efficiency |
|
| MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
|
| Allele List at MGI |
|
| Other mutations in this stock |
Total: 41 list
| Gene | Ref | Var | Chr/Loc | Mutation | Predicted Effect | Zygosity |
|---|
| Arap2 |
T |
A |
5: 62,872,089 (GRCm39) |
Y513F |
probably benign |
Het |
| Cluh |
C |
A |
11: 74,556,044 (GRCm39) |
H832N |
probably damaging |
Het |
| Cntfr |
G |
T |
4: 41,675,042 (GRCm39) |
Y21* |
probably null |
Het |
| Cog2 |
T |
C |
8: 125,273,370 (GRCm39) |
S570P |
possibly damaging |
Het |
| Cops7b |
A |
G |
1: 86,510,790 (GRCm39) |
|
probably benign |
Het |
| Cpox |
G |
A |
16: 58,495,649 (GRCm39) |
G322D |
probably damaging |
Het |
| Dop1a |
A |
G |
9: 86,402,835 (GRCm39) |
D1345G |
probably damaging |
Het |
| Dqx1 |
G |
A |
6: 83,036,700 (GRCm39) |
D235N |
possibly damaging |
Het |
| Dscaml1 |
A |
G |
9: 45,361,857 (GRCm39) |
I206V |
possibly damaging |
Het |
| Ednra |
T |
C |
8: 78,401,597 (GRCm39) |
Y231C |
probably damaging |
Het |
| Ehhadh |
T |
C |
16: 21,581,540 (GRCm39) |
Y484C |
probably damaging |
Het |
| Fmnl3 |
A |
T |
15: 99,229,871 (GRCm39) |
V150D |
probably damaging |
Het |
| Gabrb2 |
T |
A |
11: 42,312,216 (GRCm39) |
S14T |
probably benign |
Het |
| Gm10608 |
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA |
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA |
9: 118,989,792 (GRCm39) |
|
probably null |
Het |
| Gpatch2 |
T |
C |
1: 186,958,065 (GRCm39) |
L140P |
probably benign |
Het |
| Gsdmc |
A |
G |
15: 63,648,735 (GRCm39) |
Y400H |
probably damaging |
Het |
| Heatr5b |
A |
G |
17: 79,135,415 (GRCm39) |
S239P |
probably benign |
Het |
| Hmcn1 |
A |
T |
1: 150,498,995 (GRCm39) |
I4004N |
probably damaging |
Het |
| Insc |
T |
A |
7: 114,403,776 (GRCm39) |
N63K |
possibly damaging |
Het |
| Mmp28 |
T |
C |
11: 83,333,489 (GRCm39) |
H484R |
probably benign |
Het |
| Nptn |
C |
A |
9: 58,531,070 (GRCm39) |
Y64* |
probably null |
Het |
| Nsd2 |
T |
A |
5: 34,036,480 (GRCm39) |
S655T |
possibly damaging |
Het |
| Nub1 |
A |
G |
5: 24,902,414 (GRCm39) |
E253G |
probably damaging |
Het |
| Or3a1d |
T |
C |
11: 74,237,496 (GRCm39) |
R305G |
probably benign |
Het |
| Pde3b |
T |
A |
7: 114,105,425 (GRCm39) |
H452Q |
probably benign |
Het |
| Pkhd1 |
T |
C |
1: 20,462,321 (GRCm39) |
M2078V |
probably benign |
Het |
| Pkhd1 |
T |
C |
1: 20,593,658 (GRCm39) |
D1485G |
probably damaging |
Het |
| Pkhd1l1 |
A |
C |
15: 44,404,363 (GRCm39) |
T2331P |
probably damaging |
Het |
| Plk5 |
G |
A |
10: 80,198,942 (GRCm39) |
G433E |
probably damaging |
Het |
| Pnliprp2 |
T |
A |
19: 58,748,232 (GRCm39) |
D4E |
probably benign |
Het |
| Prag1 |
A |
G |
8: 36,570,839 (GRCm39) |
D474G |
probably damaging |
Het |
| Rad9a |
G |
C |
19: 4,251,517 (GRCm39) |
|
probably null |
Het |
| Slf1 |
A |
G |
13: 77,240,490 (GRCm39) |
V396A |
probably benign |
Het |
| Stat6 |
G |
A |
10: 127,488,182 (GRCm39) |
R312K |
probably benign |
Het |
| Tgm1 |
A |
T |
14: 55,948,629 (GRCm39) |
V174E |
probably damaging |
Het |
| Tnc |
A |
G |
4: 63,926,892 (GRCm39) |
V878A |
probably benign |
Het |
| Ube4b |
A |
T |
4: 149,421,881 (GRCm39) |
H969Q |
possibly damaging |
Het |
| Ubr4 |
T |
C |
4: 139,155,802 (GRCm39) |
I2209T |
probably damaging |
Het |
| Ulk2 |
A |
C |
11: 61,725,740 (GRCm39) |
L112R |
probably damaging |
Het |
| Wdr35 |
T |
C |
12: 9,028,684 (GRCm39) |
Y101H |
probably benign |
Het |
| Xpo7 |
A |
G |
14: 70,921,117 (GRCm39) |
L617P |
probably damaging |
Het |
|
| Other mutations in Psmc1 |
| Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
|---|
|
IGL01700:Psmc1
|
APN |
12 |
100,079,337 (GRCm39) |
missense |
probably damaging |
1.00 |
|
IGL02445:Psmc1
|
APN |
12 |
100,081,087 (GRCm39) |
splice site |
probably benign |
|
|
IGL02605:Psmc1
|
APN |
12 |
100,085,386 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R0018:Psmc1
|
UTSW |
12 |
100,082,951 (GRCm39) |
splice site |
probably benign |
|
|
R0018:Psmc1
|
UTSW |
12 |
100,082,951 (GRCm39) |
splice site |
probably benign |
|
|
R0427:Psmc1
|
UTSW |
12 |
100,085,487 (GRCm39) |
missense |
probably damaging |
0.96 |
|
R0534:Psmc1
|
UTSW |
12 |
100,086,389 (GRCm39) |
missense |
possibly damaging |
0.79 |
|
R0931:Psmc1
|
UTSW |
12 |
100,085,341 (GRCm39) |
missense |
probably damaging |
0.99 |
|
R1937:Psmc1
|
UTSW |
12 |
100,081,102 (GRCm39) |
missense |
probably benign |
0.26 |
|
R2405:Psmc1
|
UTSW |
12 |
100,086,362 (GRCm39) |
missense |
probably benign |
0.03 |
|
R5063:Psmc1
|
UTSW |
12 |
100,081,734 (GRCm39) |
missense |
probably damaging |
0.97 |
|
R5293:Psmc1
|
UTSW |
12 |
100,081,731 (GRCm39) |
missense |
probably benign |
0.11 |
|
R5542:Psmc1
|
UTSW |
12 |
100,086,399 (GRCm39) |
critical splice donor site |
probably null |
|
|
R7513:Psmc1
|
UTSW |
12 |
100,081,773 (GRCm39) |
missense |
probably benign |
0.19 |
|
R7993:Psmc1
|
UTSW |
12 |
100,081,824 (GRCm39) |
missense |
probably benign |
0.01 |
|
R8489:Psmc1
|
UTSW |
12 |
100,089,356 (GRCm39) |
missense |
probably benign |
0.00 |
|
| Predicted Primers |
PCR Primer
(F):5'- AGGAAAGCATGGAGTTCCCTG -3'
(R):5'- GAGACAGCCTTGAACTCCTC -3'
Sequencing Primer
(F):5'- CATGGAGTTCCCTGCTGTG -3'
(R):5'- AGACAGGTGCTTTCCTAATTAGGCC -3'
|
| Posted On |
2016-08-04 |
Incidental Mutation