Incidental Mutation 'R5381:Lrp8'
ID424704
Institutional Source Beutler Lab
Gene Symbol Lrp8
Ensembl Gene ENSMUSG00000028613
Gene Namelow density lipoprotein receptor-related protein 8, apolipoprotein e receptor
SynonymsLr8b, 4932703M08Rik, apoER2
MMRRC Submission 042956-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5381 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107802261-107876840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107869110 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 871 (H871L)
Ref Sequence ENSEMBL: ENSMUSP00000102344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030356] [ENSMUST00000106732] [ENSMUST00000106733] [ENSMUST00000126573] [ENSMUST00000143601]
Predicted Effect probably damaging
Transcript: ENSMUST00000030356
AA Change: H871L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030356
Gene: ENSMUSG00000028613
AA Change: H871L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106731
AA Change: H673L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613
AA Change: H673L

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106732
AA Change: H786L

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102343
Gene: ENSMUSG00000028613
AA Change: H786L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 164 201 4.58e-13 SMART
LDLa 204 244 1.4e-8 SMART
EGF 246 282 2.83e-5 SMART
EGF_CA 283 322 9.91e-10 SMART
LY 349 391 8.44e-4 SMART
LY 396 438 2.29e-14 SMART
LY 439 482 5.96e-13 SMART
LY 483 525 4.21e-13 SMART
LY 527 569 7.24e-3 SMART
EGF 596 642 1.56e1 SMART
low complexity region 644 660 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
transmembrane domain 733 755 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106733
AA Change: H871L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102344
Gene: ENSMUSG00000028613
AA Change: H871L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123140
Predicted Effect possibly damaging
Transcript: ENSMUST00000126573
AA Change: H669L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118020
Gene: ENSMUSG00000028613
AA Change: H669L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 163 200 4.58e-13 SMART
EGF 204 240 2.83e-5 SMART
EGF_CA 241 280 9.91e-10 SMART
LY 307 349 8.44e-4 SMART
LY 354 396 2.29e-14 SMART
LY 397 440 5.96e-13 SMART
LY 441 483 4.21e-13 SMART
LY 485 527 7.24e-3 SMART
EGF 554 600 1.56e1 SMART
transmembrane domain 616 638 N/A INTRINSIC
low complexity region 661 667 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143601
AA Change: H912L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115854
Gene: ENSMUSG00000028613
AA Change: H912L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
LDLa 330 370 1.4e-8 SMART
EGF 372 408 2.83e-5 SMART
EGF_CA 409 448 9.91e-10 SMART
LY 475 517 8.44e-4 SMART
LY 522 564 2.29e-14 SMART
LY 565 608 5.96e-13 SMART
LY 609 651 4.21e-13 SMART
LY 653 695 7.24e-3 SMART
EGF 722 768 1.56e1 SMART
low complexity region 770 786 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
transmembrane domain 859 881 N/A INTRINSIC
low complexity region 904 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146552
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired granule cell migration, radial glial scaffold formation, contextual fear conditioning, and long-term potentiation. Mutant males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,232,907 D185G probably damaging Het
1700086D15Rik G T 11: 65,153,311 S19* probably null Het
4930432E11Rik A T 7: 29,562,968 noncoding transcript Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Ankmy1 T C 1: 92,876,562 T900A probably benign Het
Anp32a A C 9: 62,372,177 E107A probably damaging Het
Arhgef40 T C 14: 51,991,849 I623T probably damaging Het
Camsap3 T A 8: 3,603,812 I483N probably damaging Het
Card9 G A 2: 26,358,883 L85F probably damaging Het
Cbfa2t2 T G 2: 154,523,929 V353G probably damaging Het
Ccdc166 A T 15: 75,980,852 L422* probably null Het
Ccdc73 A T 2: 104,989,925 N416Y probably damaging Het
Celsr2 A T 3: 108,402,757 D1552E probably damaging Het
Ces1b A T 8: 93,065,019 N317K probably benign Het
Col6a3 T C 1: 90,775,612 R2471G unknown Het
Crocc C T 4: 141,029,311 R1165H possibly damaging Het
Csmd3 T A 15: 47,741,215 Y1955F probably benign Het
Ctbp1 A T 5: 33,249,690 D232E probably benign Het
Cuedc1 T A 11: 88,187,986 probably null Het
Dctd C T 8: 48,137,414 probably benign Het
Dusp6 G A 10: 99,266,267 V226I possibly damaging Het
Gpr152 A G 19: 4,142,517 E19G probably damaging Het
Ighv16-1 T C 12: 114,068,973 T70A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Il12b C A 11: 44,407,872 D51E possibly damaging Het
Il9r T G 11: 32,190,715 D435A probably benign Het
Jakmip2 T C 18: 43,581,960 D167G probably damaging Het
Klrd1 A G 6: 129,595,434 D63G possibly damaging Het
Lactb A G 9: 66,956,015 L439P probably damaging Het
Laptm5 T C 4: 130,933,658 probably benign Het
Lgals1 A G 15: 78,930,023 D96G probably benign Het
Mfap4 A T 11: 61,487,930 I235F probably benign Het
Muc6 G A 7: 141,637,923 T2279I possibly damaging Het
Nlrp4b T A 7: 10,715,245 Y91* probably null Het
Osbp2 A G 11: 3,705,593 Y383H probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Palb2 G T 7: 122,128,413 T78K probably benign Het
Panx2 G T 15: 89,060,230 V53L probably damaging Het
Pitx1 T C 13: 55,826,079 Y313C probably damaging Het
Pjvk A G 2: 76,651,560 probably null Het
Pnldc1 T G 17: 12,890,396 K439T probably benign Het
Ppp4r4 A C 12: 103,593,098 T513P probably benign Het
Pram1 A T 17: 33,641,626 Q389L probably damaging Het
Prg4 T C 1: 150,454,453 probably benign Het
Prkch C A 12: 73,691,592 R158S probably damaging Het
Ptpn7 A T 1: 135,143,168 M332L probably damaging Het
Rad51c A T 11: 87,397,633 D241E probably benign Het
Rara T G 11: 98,971,584 I270M possibly damaging Het
Ryr2 T A 13: 11,556,658 D4898V probably damaging Het
Sec31b C T 19: 44,534,371 G218S probably damaging Het
Slc9a1 T A 4: 133,422,071 L736Q probably damaging Het
Slco2a1 A T 9: 103,068,014 D196V probably damaging Het
Sp3 C A 2: 72,970,566 A368S probably benign Het
Stk24 A T 14: 121,294,233 L337Q possibly damaging Het
Tbc1d13 A G 2: 30,137,367 T96A probably benign Het
Tm2d3 G A 7: 65,701,672 G225S probably damaging Het
Tmem55b T C 14: 50,929,038 E161G probably benign Het
Urb2 T C 8: 124,029,912 V786A probably benign Het
Usp32 C T 11: 85,059,127 probably benign Het
Usp54 C T 14: 20,586,076 G300D probably damaging Het
Vmn1r124 T A 7: 21,260,398 N74Y probably damaging Het
Vmn1r77 T A 7: 12,042,025 C175S probably damaging Het
Vmn2r62 G T 7: 42,787,795 Q422K probably benign Het
Vmn2r76 A G 7: 86,225,288 F827S probably damaging Het
Vps52 A G 17: 33,958,301 S106G possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zic2 A G 14: 122,475,815 N47S probably damaging Het
Other mutations in Lrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Lrp8 APN 4 107864076 missense probably benign 0.04
IGL01514:Lrp8 APN 4 107855684 missense probably damaging 1.00
IGL02058:Lrp8 APN 4 107870109 missense probably benign 0.25
IGL02398:Lrp8 APN 4 107847494 missense probably damaging 0.97
IGL02398:Lrp8 APN 4 107869048 missense probably damaging 1.00
IGL02706:Lrp8 APN 4 107803319 nonsense probably null
IGL02754:Lrp8 APN 4 107834755 splice site probably null
IGL02967:Lrp8 APN 4 107861234 missense probably benign 0.21
IGL03080:Lrp8 APN 4 107855799 missense probably damaging 1.00
IGL02837:Lrp8 UTSW 4 107861281 missense probably benign 0.01
R0312:Lrp8 UTSW 4 107806855 intron probably benign
R0440:Lrp8 UTSW 4 107869098 missense probably damaging 0.99
R0598:Lrp8 UTSW 4 107857237 missense possibly damaging 0.73
R1627:Lrp8 UTSW 4 107854416 missense probably damaging 0.99
R1967:Lrp8 UTSW 4 107859971 missense probably damaging 1.00
R2183:Lrp8 UTSW 4 107803265 missense probably damaging 1.00
R2208:Lrp8 UTSW 4 107855790 missense probably damaging 1.00
R2325:Lrp8 UTSW 4 107864009 missense probably benign 0.03
R3712:Lrp8 UTSW 4 107848302 missense probably benign 0.08
R4093:Lrp8 UTSW 4 107843271 nonsense probably null
R4706:Lrp8 UTSW 4 107861273 missense probably benign 0.00
R4765:Lrp8 UTSW 4 107854395 missense probably damaging 1.00
R4840:Lrp8 UTSW 4 107870037 missense possibly damaging 0.79
R4900:Lrp8 UTSW 4 107806809 intron probably benign
R5033:Lrp8 UTSW 4 107834755 splice site probably null
R5280:Lrp8 UTSW 4 107854321 missense probably damaging 1.00
R5935:Lrp8 UTSW 4 107857296 missense probably damaging 1.00
R5972:Lrp8 UTSW 4 107869070 missense probably damaging 1.00
R6076:Lrp8 UTSW 4 107847459 missense possibly damaging 0.81
R6343:Lrp8 UTSW 4 107869156 splice site probably null
R6805:Lrp8 UTSW 4 107854320 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAGGGGTTATACGGTCTG -3'
(R):5'- GTGTTCTCCCAGAGCCAAAAC -3'

Sequencing Primer
(F):5'- TTGATGCTGGGCCGGAGC -3'
(R):5'- GCCAAAACAGTGCCTGGTATGC -3'
Posted On2016-08-04