Incidental Mutation 'R0492:Pank2'
ID42525
Institutional Source Beutler Lab
Gene Symbol Pank2
Ensembl Gene ENSMUSG00000037514
Gene Namepantothenate kinase 2
Synonyms4933409I19Rik
MMRRC Submission 038690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0492 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131262495-131299188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131280260 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 235 (Y235C)
Ref Sequence ENSEMBL: ENSMUSP00000119606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150843] [ENSMUST00000184105] [ENSMUST00000184932]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138509
Predicted Effect probably benign
Transcript: ENSMUST00000145904
SMART Domains Protein: ENSMUSP00000115034
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
Pfam:Fumble 11 128 5.1e-21 PFAM
Pfam:Fumble 121 178 2.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150843
AA Change: Y235C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514
AA Change: Y235C

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183349
Predicted Effect probably benign
Transcript: ENSMUST00000183388
Predicted Effect probably benign
Transcript: ENSMUST00000184105
SMART Domains Protein: ENSMUSP00000138992
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 154 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184932
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrested spermatogenesis, azoospermia, reduced female fertility, and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A T 5: 24,554,628 L48Q probably damaging Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Adgre1 A G 17: 57,402,742 D133G unknown Het
AI314180 A G 4: 58,864,418 W288R probably damaging Het
Alpl A C 4: 137,749,576 probably null Het
Ankrd65 T C 4: 155,790,676 probably benign Het
Baalc A T 15: 38,934,085 probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Capsl A G 15: 9,461,844 probably benign Het
Ccna1 A G 3: 55,048,583 V116A probably damaging Het
Cdc42bpa C A 1: 180,101,190 H723N probably benign Het
Cfap161 T C 7: 83,794,037 I40V possibly damaging Het
CK137956 C T 4: 127,951,300 V217I probably benign Het
Cog5 A G 12: 31,869,461 T540A probably damaging Het
Cps1 T C 1: 67,157,836 W349R probably damaging Het
Crispld2 G T 8: 120,026,067 V285L probably benign Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Daam1 G A 12: 71,944,380 R256H unknown Het
Dhx38 G T 8: 109,561,944 probably benign Het
Dok4 G A 8: 94,865,136 A324V probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Dusp16 A T 6: 134,718,402 S489T probably benign Het
Erbin A T 13: 103,834,358 Y917N probably damaging Het
F13b A T 1: 139,522,559 probably null Het
Fam26f G A 10: 34,127,651 R87* probably null Het
Fdx1 C A 9: 51,963,425 A15S probably benign Het
Ffar4 A T 19: 38,097,182 Q19L probably benign Het
Folh1 A C 7: 86,746,192 V344G probably damaging Het
Fscb T A 12: 64,473,518 E391D possibly damaging Het
Gigyf2 G A 1: 87,440,846 G1083R probably damaging Het
Gm14403 C A 2: 177,508,566 H102N probably benign Het
Gm4847 A G 1: 166,630,392 F464S probably damaging Het
Gpam A T 19: 55,096,179 M56K possibly damaging Het
Gpr165 T A X: 96,717,172 F352I probably damaging Het
Grik2 T G 10: 49,101,164 I891L probably damaging Het
Gsr T C 8: 33,681,575 probably benign Het
Hhla1 A G 15: 65,936,291 F302L probably benign Het
Impg1 T C 9: 80,345,308 D453G possibly damaging Het
Inpp5d T A 1: 87,698,150 V495E possibly damaging Het
Iqce A T 5: 140,675,235 L450H probably damaging Het
Itfg2 A G 6: 128,413,523 probably null Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Kif7 T C 7: 79,713,881 Y93C probably damaging Het
Krt33a A G 11: 100,016,083 V22A probably benign Het
Lct T C 1: 128,300,582 D1058G probably damaging Het
Lrp6 G T 6: 134,480,518 D774E possibly damaging Het
Lrrc9 T A 12: 72,478,763 S828R possibly damaging Het
Ly75 A G 2: 60,308,276 W1416R probably damaging Het
Mdh2 T C 5: 135,790,150 I320T possibly damaging Het
Med13l T A 5: 118,738,495 V912E probably damaging Het
Mgarp T C 3: 51,389,035 D182G possibly damaging Het
Mllt10 T C 2: 18,146,887 probably benign Het
Mmp28 G A 11: 83,443,803 A375V probably damaging Het
Mrps23 T A 11: 88,210,685 H133Q probably benign Het
Msh6 T C 17: 87,975,251 S35P probably benign Het
Myo3a A G 2: 22,323,636 D347G possibly damaging Het
Npc1l1 T C 11: 6,223,040 K800E possibly damaging Het
Olfr1034 T C 2: 86,046,587 V35A probably benign Het
Olfr1034 T C 2: 86,046,934 F151L possibly damaging Het
Olfr1086 G A 2: 86,676,490 P281L probably damaging Het
Olfr152 T G 2: 87,782,822 I94S probably damaging Het
Olfr414 T A 1: 174,430,563 I45N possibly damaging Het
Olfr632 T C 7: 103,937,764 I128T probably benign Het
Olfr695 A T 7: 106,873,877 Y123N probably damaging Het
Osmr A C 15: 6,824,518 W570G probably damaging Het
Otol1 A T 3: 70,027,784 I370F probably damaging Het
Pias2 T C 18: 77,105,885 S187P probably damaging Het
Pkhd1l1 A G 15: 44,519,690 N1115S probably benign Het
Pld1 G T 3: 28,109,817 A800S probably damaging Het
Prex2 T C 1: 11,186,633 probably benign Het
Ptpn3 T C 4: 57,194,304 Q908R probably benign Het
Rab3gap2 T A 1: 185,252,392 probably benign Het
Rbm24 A T 13: 46,420,350 N82Y probably damaging Het
Rpl27 T C 11: 101,445,255 V47A possibly damaging Het
Serpina1f A G 12: 103,693,567 V152A possibly damaging Het
Serpina5 A G 12: 104,102,133 Y151C probably damaging Het
Serpinb7 A G 1: 107,452,007 *381W probably null Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Slc22a2 A C 17: 12,615,272 I476L probably benign Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Smim26 G A 2: 144,595,113 D61N probably damaging Het
Soat1 A T 1: 156,441,354 Y209N probably benign Het
Sorl1 T C 9: 41,991,371 H1630R probably null Het
Sptlc2 A T 12: 87,346,806 probably null Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syce1l T A 8: 113,654,068 D137E possibly damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Tcf25 C A 8: 123,381,464 P86Q probably benign Het
Tmem19 A T 10: 115,361,810 Y43* probably null Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnn A C 1: 160,120,757 I795M probably damaging Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Tra2a A T 6: 49,250,955 probably benign Het
Trappc8 A T 18: 20,866,186 F295I probably benign Het
Vmn2r101 T A 17: 19,588,983 W125R probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Ythdf2 A T 4: 132,204,468 S460R probably damaging Het
Other mutations in Pank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pank2 APN 2 131274169 missense possibly damaging 0.69
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0513:Pank2 UTSW 2 131282606 missense probably damaging 1.00
R1415:Pank2 UTSW 2 131282718 nonsense probably null
R1622:Pank2 UTSW 2 131273969 missense probably damaging 1.00
R2217:Pank2 UTSW 2 131282681 intron probably null
R4690:Pank2 UTSW 2 131274025 missense probably damaging 1.00
R4691:Pank2 UTSW 2 131296281 missense possibly damaging 0.85
R5387:Pank2 UTSW 2 131274262 missense probably benign 0.24
R6175:Pank2 UTSW 2 131280261 nonsense probably null
R6806:Pank2 UTSW 2 131262707 unclassified probably benign
R6848:Pank2 UTSW 2 131282626 missense probably damaging 0.98
R7010:Pank2 UTSW 2 131280373 missense probably benign
R7467:Pank2 UTSW 2 131274047 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGAGGTTCCTGCTTTCTGCTGC -3'
(R):5'- GAAGGATTTACCTGGTGCCTGTGAC -3'

Sequencing Primer
(F):5'- gctcacacctgtagtcctacc -3'
(R):5'- GTTCACCAGAAGCAGAGGAT -3'
Posted On2013-05-23