Incidental Mutation 'R5454:Il5'
ID 432682
Institutional Source Beutler Lab
Gene Symbol Il5
Ensembl Gene ENSMUSG00000036117
Gene Name interleukin 5
Synonyms Il-5
MMRRC Submission 043018-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R5454 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 53611621-53615930 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53614626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 89 (N89S)
Ref Sequence ENSEMBL: ENSMUSP00000043369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048605]
AlphaFold P04401
PDB Structure Crystal structure of murine interleukin-5 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048605
AA Change: N89S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043369
Gene: ENSMUSG00000036117
AA Change: N89S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL5 21 132 5.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151643
Meta Mutation Damage Score 0.6977 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of normal airway hyperreactivity resulting from aeroallergen challenge, reduced numbers of CD5+ B cells in the peritoneal cavity at 2 weeks, and some altered responses to schistosomiasis infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,051,041 (GRCm39) noncoding transcript Het
Ankfy1 A T 11: 72,637,757 (GRCm39) H483L probably benign Het
Ankrd46 C T 15: 36,479,447 (GRCm39) G215R probably damaging Het
Apobec1 T C 6: 122,558,327 (GRCm39) I143V probably benign Het
Atp2b4 C A 1: 133,657,610 (GRCm39) V627F probably damaging Het
Ccdc80 T A 16: 44,947,588 (GRCm39) Y855* probably null Het
Cd209b T C 8: 3,975,396 (GRCm39) E88G probably damaging Het
Ceacam14 T G 7: 17,548,110 (GRCm39) W67G probably damaging Het
Cope T C 8: 70,757,306 (GRCm39) V50A probably benign Het
Dcaf13 C A 15: 38,987,759 (GRCm39) D168E probably benign Het
Dhcr7 T G 7: 143,391,576 (GRCm39) M55R probably damaging Het
Enpp7 A T 11: 118,879,634 (GRCm39) Y96F probably benign Het
Esco1 T C 18: 10,584,327 (GRCm39) D60G probably benign Het
Fgfr3 G A 5: 33,880,642 (GRCm39) probably benign Het
Frzb T C 2: 80,248,259 (GRCm39) D280G probably damaging Het
Gcat A G 15: 78,920,610 (GRCm39) I317V probably benign Het
Gm13030 A T 4: 138,600,820 (GRCm39) probably benign Het
Gmds A G 13: 32,312,024 (GRCm39) L135P probably damaging Het
Htra2 G A 6: 83,030,995 (GRCm39) P138L probably damaging Het
Ints3 G A 3: 90,315,834 (GRCm39) T310M possibly damaging Het
Itih2 T C 2: 10,102,804 (GRCm39) I777V probably null Het
Kctd9 T C 14: 67,977,836 (GRCm39) L382S probably damaging Het
Loricrin A G 3: 91,988,789 (GRCm39) S166P unknown Het
Mga T A 2: 119,733,810 (GRCm39) N219K probably damaging Het
Mtmr4 A T 11: 87,501,868 (GRCm39) R641* probably null Het
Muc6 C T 7: 141,235,078 (GRCm39) A611T possibly damaging Het
Obox3-ps8 A T 17: 36,763,903 (GRCm39) noncoding transcript Het
Or5p54 A T 7: 107,554,096 (GRCm39) M83L probably benign Het
Otud4 C T 8: 80,377,671 (GRCm39) L111F possibly damaging Het
Pcdhga12 T A 18: 37,899,314 (GRCm39) S49T possibly damaging Het
Pcdhgc3 A G 18: 37,941,549 (GRCm39) D650G probably damaging Het
Pcmt1 A G 10: 7,516,509 (GRCm39) V167A probably damaging Het
Pcnt A T 10: 76,225,381 (GRCm39) probably null Het
Pcx G T 19: 4,652,504 (GRCm39) V164F probably damaging Het
Plekhg4 T C 8: 106,102,745 (GRCm39) probably null Het
Pmch A G 10: 87,927,707 (GRCm39) E136G probably damaging Het
Prkar1a A G 11: 109,550,886 (GRCm39) D80G probably benign Het
Ryr3 T C 2: 112,560,647 (GRCm39) probably null Het
Slc10a7 T C 8: 79,413,253 (GRCm39) S171P possibly damaging Het
Sox6 A T 7: 115,301,008 (GRCm39) M153K possibly damaging Het
Srgap2 T C 1: 131,217,475 (GRCm39) I946V probably benign Het
Strbp T C 2: 37,535,495 (GRCm39) E71G probably benign Het
Synpo2l C A 14: 20,712,360 (GRCm39) A87S probably damaging Het
Tnrc18 T C 5: 142,757,446 (GRCm39) D1025G unknown Het
Tnxb A G 17: 34,928,599 (GRCm39) H2671R possibly damaging Het
Tor1b GGACG GG 2: 30,846,957 (GRCm39) probably benign Het
Umodl1 A T 17: 31,205,439 (GRCm39) D649V possibly damaging Het
Usp13 G T 3: 32,959,585 (GRCm39) A559S probably damaging Het
Vps45 G A 3: 95,926,969 (GRCm39) P526L probably benign Het
Zfp687 A G 3: 94,916,457 (GRCm39) V855A probably damaging Het
Zfp771 T A 7: 126,853,448 (GRCm39) C205S probably damaging Het
Other mutations in Il5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Il5 UTSW 11 53,614,733 (GRCm39) splice site probably benign
R0893:Il5 UTSW 11 53,611,763 (GRCm39) missense probably benign
R1761:Il5 UTSW 11 53,614,557 (GRCm39) missense probably damaging 0.98
R5089:Il5 UTSW 11 53,612,655 (GRCm39) missense possibly damaging 0.68
R5861:Il5 UTSW 11 53,614,743 (GRCm39) missense probably benign 0.02
R6142:Il5 UTSW 11 53,611,805 (GRCm39) critical splice donor site probably null
R8163:Il5 UTSW 11 53,614,813 (GRCm39) missense possibly damaging 0.93
R8442:Il5 UTSW 11 53,612,651 (GRCm39) missense probably damaging 1.00
R9469:Il5 UTSW 11 53,614,824 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTGGTACCACTCACCTTTAATC -3'
(R):5'- ACTCTTGCAGGTAATCCAGGAAC -3'

Sequencing Primer
(F):5'- AACTCTATGTATCAGAGGCTGGCC -3'
(R):5'- AGGAACTGCCTCGTCCTC -3'
Posted On 2016-10-06