Incidental Mutation 'R5627:Wdr36'
ID441906
Institutional Source Beutler Lab
Gene Symbol Wdr36
Ensembl Gene ENSMUSG00000038299
Gene NameWD repeat domain 36
Synonyms5730444A13Rik
MMRRC Submission 043166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5627 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location32837225-32866420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32861638 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 717 (D717E)
Ref Sequence ENSEMBL: ENSMUSP00000132189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053663] [ENSMUST00000166214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053663
AA Change: D717E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052465
Gene: ENSMUSG00000038299
AA Change: D717E

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 673 895 9.7e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166214
AA Change: D717E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132189
Gene: ENSMUSG00000038299
AA Change: D717E

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 668 883 6.1e-72 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality before implantation. In culture, homozygous mutant embryos fail to reach the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abl1 T C 2: 31,800,583 W705R probably benign Het
Alpk1 A T 3: 127,680,647 V569D probably damaging Het
Ano3 T C 2: 110,756,953 N425S possibly damaging Het
Atad2b A G 12: 4,917,911 D68G probably benign Het
Cacna1e A G 1: 154,635,858 I173T probably damaging Het
Cenpe G T 3: 135,235,473 L716F possibly damaging Het
Cep85 A T 4: 134,134,097 L622Q probably damaging Het
Cep97 A G 16: 55,924,967 probably null Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chil5 A G 3: 106,019,635 L228P probably damaging Het
Col22a1 T C 15: 71,981,918 E265G probably damaging Het
Col3a1 T C 1: 45,331,560 probably benign Het
Cyp3a59 T A 5: 146,112,854 D497E probably benign Het
Egfem1 G T 3: 29,668,399 E175* probably null Het
Eif4g2 A G 7: 111,074,239 Y778H probably benign Het
Fam98b T C 2: 117,267,933 C295R probably damaging Het
Gm3149 A T 14: 4,324,703 I246L probably benign Het
Gm5134 A G 10: 75,986,108 T259A possibly damaging Het
Gm5150 A G 3: 15,963,400 Y236H probably damaging Het
Golga2 C A 2: 32,306,047 Y864* probably null Het
Inpp4a A G 1: 37,367,773 D199G probably damaging Het
Inpp4b T C 8: 81,743,816 probably benign Het
Kremen1 T C 11: 5,199,709 T321A probably benign Het
Map3k3 A G 11: 106,148,602 S250G probably benign Het
Mtmr10 A T 7: 64,336,752 K526M probably damaging Het
Nbea C T 3: 55,992,345 C1461Y probably damaging Het
Nckap5l A T 15: 99,427,706 N305K possibly damaging Het
Nup210l A T 3: 90,144,250 Y567F probably damaging Het
Olfr1002 T A 2: 85,647,647 I225F probably damaging Het
Olfr1242 A T 2: 89,494,044 N89K probably benign Het
Olfr1446 T A 19: 12,890,299 I93F probably damaging Het
Olfr292 G T 7: 86,695,139 V228F possibly damaging Het
Olfr661 G A 7: 104,688,170 V52M probably benign Het
Olfr742 A G 14: 50,515,800 M199V probably benign Het
Rcc1 T C 4: 132,338,143 R57G probably damaging Het
Rfx7 C T 9: 72,532,784 probably benign Het
Saraf T A 8: 34,154,645 M1K probably null Het
Serpinb9d C T 13: 33,202,693 T248I probably damaging Het
Slc38a6 A G 12: 73,343,683 I254M possibly damaging Het
Slc6a5 A G 7: 49,911,774 D18G possibly damaging Het
Supt20 A G 3: 54,713,190 D389G possibly damaging Het
Tecpr2 T A 12: 110,941,482 I1001K probably damaging Het
Vcan CAAAA CAA 13: 89,691,135 probably null Het
Zfp318 T C 17: 46,413,136 S2022P probably damaging Het
Other mutations in Wdr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Wdr36 APN 18 32845631 missense possibly damaging 0.86
IGL01975:Wdr36 APN 18 32852488 missense probably damaging 1.00
IGL02001:Wdr36 APN 18 32852888 missense probably damaging 1.00
IGL02605:Wdr36 APN 18 32851991 missense possibly damaging 0.94
IGL02625:Wdr36 APN 18 32859261 missense possibly damaging 0.51
IGL02928:Wdr36 APN 18 32847319 critical splice donor site probably null
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0331:Wdr36 UTSW 18 32852915 missense possibly damaging 0.83
R0626:Wdr36 UTSW 18 32850531 missense probably damaging 1.00
R0835:Wdr36 UTSW 18 32849082 missense possibly damaging 0.87
R1484:Wdr36 UTSW 18 32843885 missense possibly damaging 0.77
R1498:Wdr36 UTSW 18 32852968 missense possibly damaging 0.95
R3522:Wdr36 UTSW 18 32861485 intron probably null
R4521:Wdr36 UTSW 18 32841148 splice site probably null
R4902:Wdr36 UTSW 18 32859261 missense possibly damaging 0.51
R5482:Wdr36 UTSW 18 32841904 missense probably benign 0.19
R5574:Wdr36 UTSW 18 32865959 missense probably damaging 1.00
R6076:Wdr36 UTSW 18 32846945 missense probably damaging 1.00
R6186:Wdr36 UTSW 18 32852901 missense probably benign 0.19
R6228:Wdr36 UTSW 18 32842006 missense possibly damaging 0.67
R7027:Wdr36 UTSW 18 32841905 missense probably benign 0.04
R7112:Wdr36 UTSW 18 32839451 missense probably benign 0.34
X0063:Wdr36 UTSW 18 32864722 missense probably damaging 0.96
Z1088:Wdr36 UTSW 18 32866012 intron probably null
Predicted Primers PCR Primer
(F):5'- GAGGTGGGATCACTTCTTTCC -3'
(R):5'- GGACCTCTGTGATAGTACCACG -3'

Sequencing Primer
(F):5'- GGGATCACTTCTTTCCATGACAGAAC -3'
(R):5'- CTCTGTGATAGTACCACGTGAAAC -3'
Posted On2016-11-08