Incidental Mutation 'R5783:Vrtn'
ID447879
Institutional Source Beutler Lab
Gene Symbol Vrtn
Ensembl Gene ENSMUSG00000071235
Gene Namevertebrae development associated
Synonyms7420416P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5783 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84641019-84651455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84650477 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 667 (L667Q)
Ref Sequence ENSEMBL: ENSMUSP00000132050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095551] [ENSMUST00000166772] [ENSMUST00000167227] [ENSMUST00000221915] [ENSMUST00000222319]
Predicted Effect probably benign
Transcript: ENSMUST00000095551
AA Change: L667Q

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093207
Gene: ENSMUSG00000071235
AA Change: L667Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000166772
AA Change: L667Q

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128808
Gene: ENSMUSG00000071235
AA Change: L667Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000167227
AA Change: L667Q

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132050
Gene: ENSMUSG00000071235
AA Change: L667Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000221915
Predicted Effect probably benign
Transcript: ENSMUST00000222319
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,787 Y48F probably damaging Het
4930402H24Rik A C 2: 130,739,083 F582L possibly damaging Het
AI481877 A T 4: 59,076,239 L568* probably null Het
Apob A G 12: 8,001,022 D1082G probably damaging Het
Cald1 G A 6: 34,753,533 A236T possibly damaging Het
Ccdc88b A C 19: 6,853,916 C553G probably benign Het
Cenpe A G 3: 135,261,580 D2161G probably benign Het
Cep78 G T 19: 15,956,359 N618K probably benign Het
Chka A G 19: 3,864,661 N118D probably damaging Het
Dennd5a A C 7: 109,894,636 I1263S probably damaging Het
Dnm3 T C 1: 162,355,471 T92A possibly damaging Het
Dpp9 T C 17: 56,211,655 K50E probably damaging Het
Fen1 G T 19: 10,200,830 Y83* probably null Het
Gm1110 A G 9: 26,882,336 I532T probably benign Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Impdh1 A T 6: 29,206,343 F140Y possibly damaging Het
Kcnc4 T C 3: 107,447,872 D420G possibly damaging Het
Kctd19 A G 8: 105,386,980 V664A probably benign Het
Krt80 C T 15: 101,359,479 probably null Het
Lars2 T G 9: 123,461,596 M876R probably benign Het
Lrrc9 A G 12: 72,456,053 E266G possibly damaging Het
Mesd T A 7: 83,895,675 V120E probably damaging Het
Mogs C T 6: 83,118,671 T823I probably damaging Het
Mrgprh C A 17: 12,877,446 T191N probably benign Het
Mtss1 C T 15: 58,943,524 S729N probably benign Het
Muc5b G T 7: 141,858,428 E1704* probably null Het
Olfr1076 T C 2: 86,508,638 Y60H probably damaging Het
Olfr631 A T 7: 103,928,942 I40F probably damaging Het
Olfr695 C A 7: 106,873,334 V304F probably damaging Het
Osbpl8 T A 10: 111,267,783 L216* probably null Het
Pcdha5 T C 18: 36,962,481 V681A probably benign Het
Pgap3 A C 11: 98,390,464 V190G probably benign Het
Ppp2r5a A T 1: 191,354,640 Y373N probably damaging Het
Prkdc T C 16: 15,717,801 L1675P probably damaging Het
Rapgef2 T G 3: 79,087,993 I635L probably benign Het
Rusc1 T C 3: 89,088,145 D193G probably damaging Het
Ryr3 C T 2: 112,652,998 V4140I probably benign Het
Scamp5 A G 9: 57,446,070 probably null Het
Slc41a3 T C 6: 90,619,542 I31T probably benign Het
Smad9 T C 3: 54,794,442 V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
St8sia1 T C 6: 142,963,614 N52S possibly damaging Het
Svop T G 5: 114,064,935 D72A possibly damaging Het
Sybu T C 15: 44,746,414 I153V probably damaging Het
Tmem266 G T 9: 55,397,803 S32I probably damaging Het
Trpm4 G T 7: 45,310,389 R694S probably benign Het
Uqcrfs1 A G 13: 30,545,204 L15P probably damaging Het
Zc3h14 T A 12: 98,757,175 S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp617 C A 8: 71,932,464 H213N probably damaging Het
Zfp638 G A 6: 83,944,847 G652D possibly damaging Het
Zmiz2 T C 11: 6,405,081 L916P probably damaging Het
Other mutations in Vrtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Vrtn APN 12 84649063 missense probably benign 0.01
IGL01777:Vrtn APN 12 84648922 missense probably benign 0.13
IGL01911:Vrtn APN 12 84650206 missense probably benign
IGL02219:Vrtn APN 12 84648833 missense probably damaging 1.00
IGL02684:Vrtn APN 12 84650149 missense probably benign
IGL02947:Vrtn APN 12 84648484 missense probably damaging 0.98
IGL03296:Vrtn APN 12 84648848 missense probably damaging 1.00
R0044:Vrtn UTSW 12 84648605 missense probably damaging 1.00
R1546:Vrtn UTSW 12 84648508 missense probably damaging 1.00
R1584:Vrtn UTSW 12 84650081 missense probably damaging 1.00
R1693:Vrtn UTSW 12 84648655 missense probably benign 0.03
R1773:Vrtn UTSW 12 84650224 missense probably damaging 0.98
R1951:Vrtn UTSW 12 84649199 missense probably damaging 1.00
R2143:Vrtn UTSW 12 84650162 missense probably benign 0.00
R4044:Vrtn UTSW 12 84649070 missense probably damaging 1.00
R4777:Vrtn UTSW 12 84648826 missense probably damaging 1.00
R4835:Vrtn UTSW 12 84649694 missense probably damaging 0.97
R5076:Vrtn UTSW 12 84649474 missense probably damaging 1.00
R5831:Vrtn UTSW 12 84648575 missense probably damaging 1.00
R6349:Vrtn UTSW 12 84649018 missense probably damaging 1.00
R6499:Vrtn UTSW 12 84650316 missense probably benign 0.01
R6931:Vrtn UTSW 12 84650242 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTTGAACCACAGGCTATG -3'
(R):5'- GTGTGAGACCTTCATAGAGCGC -3'

Sequencing Primer
(F):5'- CTATGGAAGCTGATCAGAATGTACC -3'
(R):5'- CCGCTTCCACATGTAGTAGGTG -3'
Posted On2016-12-15