Incidental Mutation 'R5879:Gm13083'
ID455704
Institutional Source Beutler Lab
Gene Symbol Gm13083
Ensembl Gene ENSMUSG00000066688
Gene Namepredicted gene 13083
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143615003-143618595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143617591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 487 (Y487F)
Ref Sequence ENSEMBL: ENSMUSP00000101399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105773
AA Change: Y487F

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101399
Gene: ENSMUSG00000066688
AA Change: Y487F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 431 7e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Gm13083
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Gm13083 APN 4 143615073 missense probably benign 0.00
IGL02390:Gm13083 APN 4 143615325 missense probably benign 0.29
IGL02676:Gm13083 APN 4 143616097 missense possibly damaging 0.75
IGL03381:Gm13083 APN 4 143617055 splice site probably benign
IGL03410:Gm13083 APN 4 143615281 missense probably benign 0.02
H8562:Gm13083 UTSW 4 143615350 splice site probably benign
PIT4151001:Gm13083 UTSW 4 143616152 nonsense probably null
R0157:Gm13083 UTSW 4 143615796 missense probably damaging 0.98
R0352:Gm13083 UTSW 4 143615989 missense possibly damaging 0.92
R0494:Gm13083 UTSW 4 143616156 missense probably benign 0.33
R0688:Gm13083 UTSW 4 143617357 missense probably benign 0.00
R0884:Gm13083 UTSW 4 143615184 missense probably benign 0.01
R1267:Gm13083 UTSW 4 143615734 missense possibly damaging 0.95
R1418:Gm13083 UTSW 4 143616034 missense probably benign 0.15
R1761:Gm13083 UTSW 4 143615868 missense probably benign 0.00
R3148:Gm13083 UTSW 4 143617477 missense probably benign 0.30
R4063:Gm13083 UTSW 4 143615989 missense possibly damaging 0.77
R4115:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R4760:Gm13083 UTSW 4 143617231 missense probably benign 0.04
R5516:Gm13083 UTSW 4 143615683 missense possibly damaging 0.49
R5603:Gm13083 UTSW 4 143617496 nonsense probably null
R5724:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R5796:Gm13083 UTSW 4 143615208 missense probably benign 0.12
R6181:Gm13083 UTSW 4 143616258 critical splice donor site probably null
R7155:Gm13083 UTSW 4 143616165 missense probably benign 0.01
Z1088:Gm13083 UTSW 4 143615232 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACCCTGGAAAAGTACCCTGC -3'
(R):5'- CTGTAGACATTGGGCTGAAAATAAGC -3'

Sequencing Primer
(F):5'- GCCCCTGATGAAGTCTATGATGAC -3'
(R):5'- GGCTGAAAATAAGCTCATGGTTTTCC -3'
Posted On2017-02-10