Incidental Mutation 'R6423:Actl7b'
ID518232
Institutional Source Beutler Lab
Gene Symbol Actl7b
Ensembl Gene ENSMUSG00000070980
Gene Nameactin-like 7b
SynonymsENSMUSG00000070980, Tact1, t-actin 1
MMRRC Submission 044386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6423 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location56740005-56741443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56741213 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 48 (I48M)
Ref Sequence ENSEMBL: ENSMUSP00000092693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably benign
Transcript: ENSMUST00000095079
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
AA Change: I48M

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980
AA Change: I48M

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7B), and related gene, ACTL7A, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7B gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. Unlike ACTL7A, the ACTL7B gene is expressed predominantly in the testis, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,778 M2842L probably benign Het
Adgrb1 G T 15: 74,588,143 probably null Het
Arhgap10 G T 8: 77,517,757 S9R probably damaging Het
Bcl11b T C 12: 107,915,419 E807G possibly damaging Het
C130060K24Rik A G 6: 65,456,093 N299S probably benign Het
Chia1 A G 3: 106,128,988 T295A possibly damaging Het
Cnrip1 T C 11: 17,052,350 probably null Het
Ets1 A G 9: 32,738,315 K316R probably damaging Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Flnc G A 6: 29,445,156 probably null Het
Foxf1 G A 8: 121,085,095 G233R possibly damaging Het
H2-DMa A G 17: 34,137,196 I57M probably benign Het
Insr C T 8: 3,173,566 V856I probably benign Het
Iqub T C 6: 24,491,529 D386G probably damaging Het
Kcna3 C A 3: 107,036,842 Y140* probably null Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mgam A G 6: 40,677,045 Y844C possibly damaging Het
Nbeal2 T C 9: 110,625,994 Q2605R probably damaging Het
Ncor2 A G 5: 125,087,902 I316T unknown Het
Nell2 A T 15: 95,527,282 F63Y probably damaging Het
Olfr323 T C 11: 58,625,363 I228V probably damaging Het
Zfp386 A G 12: 116,060,113 I449V probably damaging Het
Other mutations in Actl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Actl7b APN 4 56740677 missense probably damaging 1.00
IGL02252:Actl7b APN 4 56741205 missense probably damaging 0.97
IGL02927:Actl7b APN 4 56740609 missense probably damaging 1.00
IGL03370:Actl7b APN 4 56741173 missense probably damaging 1.00
R0294:Actl7b UTSW 4 56740848 missense possibly damaging 0.83
R1711:Actl7b UTSW 4 56740165 nonsense probably null
R4773:Actl7b UTSW 4 56740972 missense probably benign
R6110:Actl7b UTSW 4 56740224 missense probably damaging 1.00
R7039:Actl7b UTSW 4 56741022 missense probably damaging 0.98
R7250:Actl7b UTSW 4 56741035 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACCAGCTTCAGAGATGCC -3'
(R):5'- TTTCTTCCCAGGAGCTCTAGGG -3'

Sequencing Primer
(F):5'- TCAGAGATGCCTCCATGTTGAGC -3'
(R):5'- TCCCAGGAGCTCTAGGGTATGG -3'
Posted On2018-05-24