Incidental Mutation 'R6509:1700007G11Rik'
List |< first << previous [record 42 of 33389] next >> last >|
ID519862
Institutional Source Beutler Lab
Gene Symbol 1700007G11Rik
Ensembl Gene ENSMUSG00000057816
Gene NameRIKEN cDNA 1700007G11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6509 (G1)
Quality Score190.009
Status Not validated
Chromosome5
Chromosomal Location98329304-98802047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98329397 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 15 (T15I)
Ref Sequence ENSEMBL: ENSMUSP00000079208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080333]
Predicted Effect probably benign
Transcript: ENSMUST00000080333
AA Change: T15I

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079208
Gene: ENSMUSG00000057816
AA Change: T15I

DomainStartEndE-ValueType
Pfam:DUF4464 12 232 7.1e-100 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000196339
AA Change: T9I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197812
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,384 R203* probably null Het
Ccnc A G 4: 21,740,642 N133D probably benign Het
Lbhd2 A G 12: 111,410,313 R65G possibly damaging Het
Lrrc37a A G 11: 103,504,414 S62P probably benign Het
Map3k1 T A 13: 111,753,829 M1279L possibly damaging Het
Ncapg2 G A 12: 116,427,756 R475Q probably damaging Het
Nlrp5 A T 7: 23,417,916 N355I probably damaging Het
Olfr847 A G 9: 19,375,143 V246A probably benign Het
Pdzd8 A G 19: 59,344,866 F241S probably benign Het
Rgl3 A G 9: 21,971,908 S705P probably benign Het
Rsbn1 A G 3: 103,960,032 Y563C probably damaging Het
Sept9 A G 11: 117,290,427 I18V probably benign Het
Sycp2 G A 2: 178,395,894 P153S probably damaging Het
Tbc1d4 C A 14: 101,608,318 R48L possibly damaging Het
Vmn1r195 G A 13: 22,279,109 G250R probably benign Het
Vmn2r66 G T 7: 85,006,846 P321T probably benign Het
Other mutations in 1700007G11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:1700007G11Rik APN 5 98784510 missense probably benign 0.00
IGL01133:1700007G11Rik APN 5 98498381 critical splice donor site probably null
IGL02151:1700007G11Rik APN 5 98329442 missense probably damaging 1.00
LCD18:1700007G11Rik UTSW 5 98707508 intron probably benign
R0962:1700007G11Rik UTSW 5 98566561 intron probably benign
R1545:1700007G11Rik UTSW 5 98329432 missense probably benign 0.25
R1886:1700007G11Rik UTSW 5 98801831 missense probably benign 0.41
R1954:1700007G11Rik UTSW 5 98566753 intron probably benign
R1965:1700007G11Rik UTSW 5 98346234 missense probably damaging 1.00
R2008:1700007G11Rik UTSW 5 98737702 missense possibly damaging 0.90
R3873:1700007G11Rik UTSW 5 98737623 missense probably damaging 1.00
R4940:1700007G11Rik UTSW 5 98737636 missense possibly damaging 0.95
R5708:1700007G11Rik UTSW 5 98737707 missense probably benign
R6595:1700007G11Rik UTSW 5 98801858 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CCTTCGGACTTTGCTAAGGC -3'
(R):5'- ACTACTTTACAGCGACCAAGTC -3'

Sequencing Primer
(F):5'- GGACTTTGCTAAGGCTTTTACAC -3'
(R):5'- AAGTCGGCCTCTGTGCAG -3'
Posted On2018-06-06