Incidental Mutation 'R6634:4921539E11Rik'
List |< first << previous [record 57 of 9592] next >> last >|
ID525369
Institutional Source Beutler Lab
Gene Symbol 4921539E11Rik
Ensembl Gene ENSMUSG00000028520
Gene NameRIKEN cDNA 4921539E11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.012) question?
Stock #R6634 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location103230445-103290863 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 103236930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030245] [ENSMUST00000097944] [ENSMUST00000168664]
Predicted Effect probably null
Transcript: ENSMUST00000030245
SMART Domains Protein: ENSMUSP00000030245
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 443 6.1e-206 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097944
SMART Domains Protein: ENSMUSP00000095557
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 270 7.3e-116 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168664
SMART Domains Protein: ENSMUSP00000131846
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 342 4.4e-183 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12b C A 11: 69,168,821 Y566* probably null Het
Chl1 T A 6: 103,690,259 S403R probably damaging Het
Cpa5 T A 6: 30,626,364 D241E probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2t4 C A 7: 27,155,788 C121* probably null Het
Dkkl1 C A 7: 45,210,458 R56L possibly damaging Het
Ebf3 A G 7: 137,201,160 V387A probably damaging Het
Fer1l5 A G 1: 36,411,385 T1212A probably damaging Het
Galnt16 T A 12: 80,519,170 M1K probably null Het
Gm11639 T C 11: 104,893,783 M2797T probably benign Het
Gm5800 A G 14: 51,716,138 S7P possibly damaging Het
Gstp1 T A 19: 4,035,510 H199L probably benign Het
Herc1 T C 9: 66,437,744 S1940P probably benign Het
Igkv8-24 C T 6: 70,217,381 W14* probably null Het
Iqcd C A 5: 120,600,491 Q125K probably benign Het
Lpin2 T A 17: 71,246,418 D812E probably damaging Het
Ltb4r2 T A 14: 55,762,505 probably null Het
Morc2a T C 11: 3,672,376 probably null Het
Myh1 A T 11: 67,209,064 N600I possibly damaging Het
Nedd9 T A 13: 41,312,108 K685N probably damaging Het
Olfr432 A G 1: 174,050,969 I199V probably benign Het
Otogl A C 10: 107,862,304 V735G probably damaging Het
Pcnx T A 12: 81,917,882 Y274* probably null Het
Pias1 A T 9: 62,919,424 I252N probably damaging Het
Pitpnm3 T C 11: 72,051,929 D828G probably null Het
Satb2 G T 1: 56,845,721 S348* probably null Het
Sfxn1 T A 13: 54,093,029 V180D probably damaging Het
Slc35g3 A T 11: 69,760,283 V314D probably damaging Het
Tmem200c C A 17: 68,842,106 D561E probably benign Het
Usp53 T A 3: 122,964,286 Q69L probably benign Het
Other mutations in 4921539E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:4921539E11Rik APN 4 103235786 missense possibly damaging 0.95
IGL00864:4921539E11Rik APN 4 103235698 missense probably damaging 1.00
IGL01951:4921539E11Rik APN 4 103235668 missense probably damaging 1.00
IGL02477:4921539E11Rik APN 4 103270746 missense probably benign 0.04
IGL02606:4921539E11Rik APN 4 103242781 missense probably benign 0.01
IGL03210:4921539E11Rik APN 4 103284438 missense probably benign 0.01
R0441:4921539E11Rik UTSW 4 103235492 intron probably benign
R0455:4921539E11Rik UTSW 4 103230983 missense possibly damaging 0.69
R0504:4921539E11Rik UTSW 4 103270860 splice site probably benign
R0636:4921539E11Rik UTSW 4 103231217 missense probably damaging 1.00
R0766:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R0799:4921539E11Rik UTSW 4 103242904 missense possibly damaging 0.83
R1312:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R1713:4921539E11Rik UTSW 4 103270767 missense possibly damaging 0.92
R1783:4921539E11Rik UTSW 4 103231089 missense probably damaging 0.99
R1978:4921539E11Rik UTSW 4 103270764 missense possibly damaging 0.49
R3735:4921539E11Rik UTSW 4 103266406 missense probably damaging 1.00
R4821:4921539E11Rik UTSW 4 103235674 missense probably damaging 1.00
R5274:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5275:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5431:4921539E11Rik UTSW 4 103270848 missense probably benign 0.00
R5449:4921539E11Rik UTSW 4 103266382 missense probably benign
R6049:4921539E11Rik UTSW 4 103231323 missense probably benign 0.05
R6277:4921539E11Rik UTSW 4 103231471 nonsense probably null
R6518:4921539E11Rik UTSW 4 103266411 missense probably damaging 1.00
R6602:4921539E11Rik UTSW 4 103255572 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TAGGAAGCCCACTAGCTGAC -3'
(R):5'- GCCACTATGCCAGAAGTTTTC -3'

Sequencing Primer
(F):5'- ACTAGCTGACCAGTCTGGG -3'
(R):5'- CCTTTGGAAGAACAGTCAGTGCTC -3'
Posted On2018-06-22