Incidental Mutation 'R6672:Dpf1'
ID527170
Institutional Source Beutler Lab
Gene Symbol Dpf1
Ensembl Gene ENSMUSG00000030584
Gene NameD4, zinc and double PHD fingers family 1
Synonymsneuro-d4, Neud4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R6672 (G1)
Quality Score185.009
Status Validated
Chromosome7
Chromosomal Location29303951-29318243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29316268 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 357 (C357R)
Ref Sequence ENSEMBL: ENSMUSP00000103866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049977] [ENSMUST00000065181] [ENSMUST00000085809] [ENSMUST00000108230] [ENSMUST00000108231] [ENSMUST00000183096]
Predicted Effect probably damaging
Transcript: ENSMUST00000049977
AA Change: C347R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054385
Gene: ENSMUSG00000030584
AA Change: C347R

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 1.6e-39 PFAM
ZnF_C2H2 196 219 2.4e-3 SMART
PHD 274 327 8.98e-7 SMART
RING 275 326 1.06e1 SMART
PHD 328 374 2.6e-12 SMART
RING 329 373 8.53e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065181
AA Change: C346R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070539
Gene: ENSMUSG00000030584
AA Change: C346R

DomainStartEndE-ValueType
Pfam:Requiem_N 11 84 2e-39 PFAM
ZnF_C2H2 195 218 2.4e-3 SMART
PHD 273 326 8.98e-7 SMART
RING 274 325 1.06e1 SMART
PHD 327 373 2.6e-12 SMART
RING 328 372 8.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085809
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108230
AA Change: C312R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103865
Gene: ENSMUSG00000030584
AA Change: C312R

DomainStartEndE-ValueType
Pfam:Requiem_N 11 84 9.7e-40 PFAM
PHD 229 282 8.98e-7 SMART
RING 230 281 1.06e1 SMART
PHD 283 339 6.85e-12 SMART
RING 284 338 9.5e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108231
AA Change: C357R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103866
Gene: ENSMUSG00000030584
AA Change: C357R

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 1.2e-39 PFAM
ZnF_C2H2 196 219 2.4e-3 SMART
PHD 274 327 8.98e-7 SMART
RING 275 326 1.06e1 SMART
PHD 328 384 6.85e-12 SMART
RING 329 383 9.5e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128145
Predicted Effect probably benign
Transcript: ENSMUST00000137848
SMART Domains Protein: ENSMUSP00000120956
Gene: ENSMUSG00000030584

DomainStartEndE-ValueType
Pfam:Requiem_N 1 40 8.9e-20 PFAM
ZnF_C2H2 122 143 5.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138993
Predicted Effect probably benign
Transcript: ENSMUST00000142958
SMART Domains Protein: ENSMUSP00000117186
Gene: ENSMUSG00000030584

DomainStartEndE-ValueType
ZnF_C2H2 21 44 2.4e-3 SMART
PHD 82 135 8.98e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182223
Predicted Effect probably benign
Transcript: ENSMUST00000183096
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Dpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Dpf1 APN 7 29316556 unclassified probably benign
IGL00736:Dpf1 APN 7 29312908 nonsense probably null
IGL01804:Dpf1 APN 7 29316501 missense probably damaging 1.00
IGL01942:Dpf1 APN 7 29316502 missense probably damaging 1.00
IGL01953:Dpf1 APN 7 29314307 missense probably damaging 1.00
IGL03191:Dpf1 APN 7 29316561 unclassified probably benign
R3622:Dpf1 UTSW 7 29316206 unclassified probably null
R3924:Dpf1 UTSW 7 29311673 missense possibly damaging 0.76
R4234:Dpf1 UTSW 7 29315632 missense probably damaging 1.00
R4606:Dpf1 UTSW 7 29316590 unclassified probably benign
R5379:Dpf1 UTSW 7 29304108 missense probably benign 0.02
R5434:Dpf1 UTSW 7 29311331 missense possibly damaging 0.92
R6185:Dpf1 UTSW 7 29311271 missense possibly damaging 0.92
R6816:Dpf1 UTSW 7 29311662 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCAGTACAAAATCCGACTCCGTG -3'
(R):5'- TTCAAGTGCCGGAGACAGAG -3'

Sequencing Primer
(F):5'- CCAGTTTTCTCAGAAGGG -3'
(R):5'- TTAGACTGGAGCCCGATGG -3'
Posted On2018-07-23