Mutagenetix > Incidental Mutation

Incidental Mutation 'R6732:Pigp'

530124

Institutional Source

Beutler Lab

Gene Symbol

Pigp

Ensembl Gene

ENSMUSG00000022940

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class P

Synonyms

Dcrc, Dscr5

MMRRC Submission

044850-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.712) question?

Stock #

R6732 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94159622-94171874 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 94166300 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 96 (L96R)

Ref Sequence

ENSEMBL: ENSMUSP00000109550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113905] [ENSMUST00000113906] [ENSMUST00000113910] [ENSMUST00000113914] [ENSMUST00000113917] [ENSMUST00000138514] [ENSMUST00000232294]

AlphaFold

Q9JHG1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113905
AA Change: L63R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940
AA Change: L63R

Domain	Start	End	E-Value	Type
Pfam:PIG-P	10	125	7.6e-45	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113906
AA Change: L63R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940
AA Change: L63R

Domain	Start	End	E-Value	Type
Pfam:PIG-P	10	125	7.6e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113910
AA Change: L92R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940
AA Change: L92R

Domain	Start	End	E-Value	Type
Pfam:PIG-P	39	154	1.5e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113914
AA Change: L136R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940
AA Change: L136R

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
Pfam:PIG-P	84	197	1e-43	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113917
AA Change: L96R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109550
Gene: ENSMUSG00000022940
AA Change: L96R

Domain	Start	End	E-Value	Type
Pfam:PIG-P	43	135	5.6e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000138514
AA Change: L96R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114477
Gene: ENSMUSG00000022940
AA Change: L96R

Domain	Start	End	E-Value	Type
Pfam:PIG-P	43	152	1.2e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146924

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232294
AA Change: L63R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.8467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,117,190 (GRCm39)	I486T	probably damaging	Het
Abcc5	T	C	16: 20,223,434 (GRCm39)	N158S	probably benign	Het
AI182371	G	T	2: 34,974,717 (GRCm39)		probably benign	Het
Ap1ar	G	A	3: 127,609,334 (GRCm39)	Q96*	probably null	Het
Cd101	C	T	3: 100,915,515 (GRCm39)	S684N	probably benign	Het
Cdh16	T	G	8: 105,345,165 (GRCm39)	I375L	probably benign	Het
Chchd6	A	G	6: 89,551,436 (GRCm39)	V75A	probably benign	Het
Coro2a	A	T	4: 46,551,374 (GRCm39)	N110K	probably damaging	Het
Cyp2c69	A	G	19: 39,869,943 (GRCm39)	V93A	probably benign	Het
Dnaaf9	A	G	2: 130,652,740 (GRCm39)		probably null	Het
Egln3	C	T	12: 54,227,427 (GRCm39)	A235T	probably benign	Het
Fryl	T	C	5: 73,212,124 (GRCm39)	T2335A	probably damaging	Het
Fzd3	T	C	14: 65,473,252 (GRCm39)	D172G	probably benign	Het
Galnt2	T	A	8: 125,067,561 (GRCm39)	W447R	probably damaging	Het
Iqce	A	G	5: 140,660,990 (GRCm39)	L450P	probably benign	Het
Ly9	T	C	1: 171,421,653 (GRCm39)	T533A	possibly damaging	Het
Map3k19	A	C	1: 127,751,969 (GRCm39)	F257V	probably benign	Het
Mroh7	GTT	GTTT	4: 106,537,910 (GRCm39)		probably null	Het
Or5ac20	A	T	16: 59,104,314 (GRCm39)	V182E	probably benign	Het
Pcdhb11	A	T	18: 37,555,197 (GRCm39)	I176F	probably benign	Het
Pkd1	A	G	17: 24,788,387 (GRCm39)	D715G	probably damaging	Het
Plxnd1	A	C	6: 115,946,890 (GRCm39)	L828R	possibly damaging	Het
Pramel15	C	T	4: 144,099,743 (GRCm39)	V341I	probably benign	Het
Psmd2	T	A	16: 20,481,386 (GRCm39)	S814T	probably benign	Het
Pusl1	A	G	4: 155,975,573 (GRCm39)	S87P	probably benign	Het
Rgs3	T	A	4: 62,521,180 (GRCm39)	D34E	probably benign	Het
Rhof	A	G	5: 123,269,999 (GRCm39)	F53L	probably damaging	Het
Sik3	C	A	9: 46,123,851 (GRCm39)	P1217T	probably benign	Het
Skic2	G	A	17: 35,064,166 (GRCm39)	R507*	probably null	Het
Slc14a2	A	G	18: 78,235,389 (GRCm39)	Y263H	probably damaging	Het
Slc26a4	C	T	12: 31,576,599 (GRCm39)		probably null	Het
Smyd3	T	G	1: 179,223,395 (GRCm39)	H178P	probably benign	Het
Thada	T	C	17: 84,761,842 (GRCm39)		probably null	Het
Top1mt	A	C	15: 75,541,337 (GRCm39)		probably null	Het
Trim17	A	T	11: 58,861,851 (GRCm39)		probably null	Het
Ttn	A	T	2: 76,770,395 (GRCm39)	F2599I	possibly damaging	Het
Tuba3a	A	T	6: 125,258,608 (GRCm39)	D127E	probably benign	Het
Ucp1	A	G	8: 84,018,106 (GRCm39)	T68A	probably benign	Het
Vmn2r69	A	G	7: 85,060,351 (GRCm39)	V411A	probably benign	Het
Vmn2r74	A	T	7: 85,606,758 (GRCm39)	V196E	probably damaging	Het
Wdr59	T	C	8: 112,227,684 (GRCm39)	Y131C	probably damaging	Het
Yod1	G	A	1: 130,645,275 (GRCm39)	G19S	probably damaging	Het
Zbtb21	G	T	16: 97,752,282 (GRCm39)	S667Y	probably damaging	Het

Other mutations in Pigp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02100:Pigp	APN	16	94,165,626 (GRCm39)	nonsense	probably null
IGL02728:Pigp	APN	16	94,168,466 (GRCm39)	missense	probably damaging	1.00
schweinchen	UTSW	16	94,166,300 (GRCm39)	missense	probably damaging	1.00
R0092:Pigp	UTSW	16	94,166,321 (GRCm39)	missense	probably damaging	0.96
R3614:Pigp	UTSW	16	94,165,583 (GRCm39)	missense	possibly damaging	0.91
R4872:Pigp	UTSW	16	94,166,309 (GRCm39)	missense	probably benign	0.18
R4959:Pigp	UTSW	16	94,160,006 (GRCm39)	missense	probably benign	0.00
R4973:Pigp	UTSW	16	94,160,006 (GRCm39)	missense	probably benign	0.00
R5970:Pigp	UTSW	16	94,171,053 (GRCm39)	critical splice acceptor site	probably null
R6135:Pigp	UTSW	16	94,171,065 (GRCm39)	missense	probably benign	0.20
R6179:Pigp	UTSW	16	94,171,226 (GRCm39)	missense	probably null	0.99
R7576:Pigp	UTSW	16	94,171,264 (GRCm39)	missense	probably benign	0.40
R8202:Pigp	UTSW	16	94,165,528 (GRCm39)	missense	probably benign	0.43
R9234:Pigp	UTSW	16	94,165,522 (GRCm39)	makesense	probably null
R9645:Pigp	UTSW	16	94,166,278 (GRCm39)	nonsense	probably null
R9768:Pigp	UTSW	16	94,166,332 (GRCm39)	missense	probably damaging	1.00
Z1177:Pigp	UTSW	16	94,171,554 (GRCm39)	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GAATGTATCAGATGACTTTCTCCCAAC -3'
(R):5'- TCTGCAGCTGTTCATTGGCC -3'

Sequencing Primer
(F):5'- AACGTGTTTCTTAGGCCTATTTCTG -3'
(R):5'- AGCTGTTCATTGGCCCCTTATAG -3'

Posted On

2018-08-01