Incidental Mutation 'R6796:Poglut1'
ID533030
Institutional Source Beutler Lab
Gene Symbol Poglut1
Ensembl Gene ENSMUSG00000034064
Gene Nameprotein O-glucosyltransferase 1
SynonymsRumi, Ktelc1, 9630046K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6796 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38525137-38550258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38529610 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 267 (Y267C)
Ref Sequence ENSEMBL: ENSMUSP00000038166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036210]
Predicted Effect probably damaging
Transcript: ENSMUST00000036210
AA Change: Y267C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064
AA Change: Y267C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CAP10 121 373 6.69e-102 SMART
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality during organogenesis, embryonic growth retardation, caudal body truncation, and severe defects in neural tube development, somitogenesis, cardiogenesis, and vascular remodeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Poglut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Poglut1 APN 16 38542916 missense possibly damaging 0.96
R0646:Poglut1 UTSW 16 38529475 missense probably damaging 0.99
R0799:Poglut1 UTSW 16 38534721 splice site probably null
R2025:Poglut1 UTSW 16 38537905 critical splice donor site probably null
R2054:Poglut1 UTSW 16 38534807 missense probably damaging 1.00
R4514:Poglut1 UTSW 16 38549416 missense probably benign 0.00
R4770:Poglut1 UTSW 16 38534757 missense probably damaging 1.00
R5649:Poglut1 UTSW 16 38531811 missense probably damaging 0.99
R5893:Poglut1 UTSW 16 38529595 missense probably damaging 0.99
R7404:Poglut1 UTSW 16 38537922 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTGCTTACTGGACATTGGAGAG -3'
(R):5'- ACATACTGATGTGTCCTTGAAGA -3'

Sequencing Primer
(F):5'- ACATTGGAGAGGTCGGTCTTGAC -3'
(R):5'- GTTGGTGTCAAGCTCACAAC -3'
Posted On2018-08-29